ID: 1135073738

View in Genome Browser
Species Human (GRCh38)
Location 16:19375353-19375375
Sequence GATCCAGATGCTGGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135073738_1135073747 24 Left 1135073738 16:19375353-19375375 CCTGTAAAACCAGCATCTGGATC No data
Right 1135073747 16:19375400-19375422 CCCAGGAGCCCCCTCATACCTGG No data
1135073738_1135073740 7 Left 1135073738 16:19375353-19375375 CCTGTAAAACCAGCATCTGGATC No data
Right 1135073740 16:19375383-19375405 AACTCTATGACCCCTCCCCCAGG No data
1135073738_1135073749 28 Left 1135073738 16:19375353-19375375 CCTGTAAAACCAGCATCTGGATC No data
Right 1135073749 16:19375404-19375426 GGAGCCCCCTCATACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135073738 Original CRISPR GATCCAGATGCTGGTTTTAC AGG (reversed) Intergenic
No off target data available for this crispr