ID: 1135074485

View in Genome Browser
Species Human (GRCh38)
Location 16:19381815-19381837
Sequence GGCCAACAGCCTAGTTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135074485_1135074491 23 Left 1135074485 16:19381815-19381837 CCTTCAGAACTAGGCTGTTGGCC No data
Right 1135074491 16:19381861-19381883 ATTTCACTTGGACTATGACTAGG No data
1135074485_1135074490 11 Left 1135074485 16:19381815-19381837 CCTTCAGAACTAGGCTGTTGGCC No data
Right 1135074490 16:19381849-19381871 TTGTGTCTTGCTATTTCACTTGG No data
1135074485_1135074492 30 Left 1135074485 16:19381815-19381837 CCTTCAGAACTAGGCTGTTGGCC No data
Right 1135074492 16:19381868-19381890 TTGGACTATGACTAGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135074485 Original CRISPR GGCCAACAGCCTAGTTCTGA AGG (reversed) Intergenic
No off target data available for this crispr