ID: 1135075930

View in Genome Browser
Species Human (GRCh38)
Location 16:19393593-19393615
Sequence CCCACTGGGTGGTGTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135075930_1135075942 3 Left 1135075930 16:19393593-19393615 CCAGCCCCACACCACCCAGTGGG No data
Right 1135075942 16:19393619-19393641 CCTGAGTCTGGTGGAGACATAGG No data
1135075930_1135075937 -9 Left 1135075930 16:19393593-19393615 CCAGCCCCACACCACCCAGTGGG No data
Right 1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG No data
1135075930_1135075939 -6 Left 1135075930 16:19393593-19393615 CCAGCCCCACACCACCCAGTGGG No data
Right 1135075939 16:19393610-19393632 AGTGGGTACCCTGAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135075930 Original CRISPR CCCACTGGGTGGTGTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr