ID: 1135082874

View in Genome Browser
Species Human (GRCh38)
Location 16:19451441-19451463
Sequence CAGAATGGCTTTAATTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135082864_1135082874 26 Left 1135082864 16:19451392-19451414 CCGTTGGGATATAAATGATCACA No data
Right 1135082874 16:19451441-19451463 CAGAATGGCTTTAATTATCAGGG No data
1135082870_1135082874 -10 Left 1135082870 16:19451428-19451450 CCCCACTGGGGCACAGAATGGCT No data
Right 1135082874 16:19451441-19451463 CAGAATGGCTTTAATTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135082874 Original CRISPR CAGAATGGCTTTAATTATCA GGG Intronic
No off target data available for this crispr