ID: 1135085713

View in Genome Browser
Species Human (GRCh38)
Location 16:19473042-19473064
Sequence CTCACACAAAAGTGCAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135085707_1135085713 -5 Left 1135085707 16:19473024-19473046 CCCAGTGCCTCTCCCAGCCTCAC No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data
1135085705_1135085713 6 Left 1135085705 16:19473013-19473035 CCTCCTGGAGGCCCAGTGCCTCT No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data
1135085708_1135085713 -6 Left 1135085708 16:19473025-19473047 CCAGTGCCTCTCCCAGCCTCACA No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data
1135085706_1135085713 3 Left 1135085706 16:19473016-19473038 CCTGGAGGCCCAGTGCCTCTCCC No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data
1135085702_1135085713 20 Left 1135085702 16:19472999-19473021 CCAGAGTGCTGCCTCCTCCTGGA No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data
1135085704_1135085713 9 Left 1135085704 16:19473010-19473032 CCTCCTCCTGGAGGCCCAGTGCC No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data
1135085700_1135085713 27 Left 1135085700 16:19472992-19473014 CCAAATGCCAGAGTGCTGCCTCC No data
Right 1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135085713 Original CRISPR CTCACACAAAAGTGCAGCAC AGG Intronic
No off target data available for this crispr