ID: 1135087757

View in Genome Browser
Species Human (GRCh38)
Location 16:19488494-19488516
Sequence CAGTGGAGCCAAAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135087757_1135087768 10 Left 1135087757 16:19488494-19488516 CCCACTTCCCTTTGGCTCCACTG No data
Right 1135087768 16:19488527-19488549 CACCACCCTCACCCCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135087757 Original CRISPR CAGTGGAGCCAAAGGGAAGT GGG (reversed) Intronic
No off target data available for this crispr