ID: 1135091627

View in Genome Browser
Species Human (GRCh38)
Location 16:19522274-19522296
Sequence ACCTGGGCGTTCAGACTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135091624_1135091627 -6 Left 1135091624 16:19522257-19522279 CCGAGGTCTGAACTTCAACCTGG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1135091627 16:19522274-19522296 ACCTGGGCGTTCAGACTCCTAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1135091622_1135091627 20 Left 1135091622 16:19522231-19522253 CCAAATCTAAGGTGGGTTAGGGT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1135091627 16:19522274-19522296 ACCTGGGCGTTCAGACTCCTAGG 0: 1
1: 0
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135091627 Original CRISPR ACCTGGGCGTTCAGACTCCT AGG Intergenic
902155131 1:14478984-14479006 AACTGGGAGTTGAGACTCCTGGG + Intergenic
905474851 1:38218872-38218894 ACCTGGGGCCTCAGCCTCCTGGG - Intergenic
909120745 1:71600486-71600508 ACCTAGTCCTTCAGTCTCCTTGG - Intronic
915417659 1:155754471-155754493 ATCTGGCCATTCAGTCTCCTAGG + Exonic
917646995 1:177039058-177039080 ACCTGGGCTTTCTGAACCCTTGG + Intronic
921070096 1:211651254-211651276 ACCTGGGTGGTCACACTCGTGGG - Intergenic
922619791 1:226982599-226982621 ACCTGGGCGGGCACACTCCTGGG - Intronic
924696526 1:246406133-246406155 GCCTGGGAGTTCAAGCTCCTGGG - Intronic
1068140853 10:53005191-53005213 ACCTGGGAGATCAGACATCTGGG + Intergenic
1069396990 10:68000326-68000348 ACCTGGGCCTTCAAAGTGCTGGG - Intronic
1069495037 10:68896168-68896190 ATCTGAGATTTCAGACTCCTAGG + Intergenic
1070586223 10:77768788-77768810 CCCTTGGCCTTCTGACTCCTGGG - Intergenic
1071604249 10:86973673-86973695 ACCTTGGCCTTCAGAGTACTGGG - Intronic
1072142788 10:92604565-92604587 ACCTGGGAGTTAAGTTTCCTAGG + Intronic
1072611677 10:97021248-97021270 ACCTTGGCATTCAAACTTCTTGG + Exonic
1072783410 10:98265163-98265185 GGCTGGGCGGTCAGACTGCTGGG + Intronic
1077357095 11:2123436-2123458 ACCAGGGAGGCCAGACTCCTGGG + Intergenic
1084797633 11:71519055-71519077 ACCCGGGCCTGCAGCCTCCTCGG + Intronic
1085533928 11:77207051-77207073 GCCTTGGCGTCCAGAGTCCTGGG - Intronic
1087570815 11:99925574-99925596 CCCTTGGCCTTGAGACTCCTTGG + Intronic
1088477893 11:110262939-110262961 AACTAGGTTTTCAGACTCCTAGG - Intronic
1092080322 12:5710711-5710733 ACATGGGAGTTCTGACTTCTAGG + Intronic
1102527542 12:113522404-113522426 ACCTGGGCAGTCAGATTCCCAGG - Intergenic
1102953718 12:117046379-117046401 ACTTGGACCTTCAGTCTCCTGGG + Intronic
1103491007 12:121320383-121320405 ACCTGGGCGTGCTGACTATTAGG + Exonic
1103495423 12:121358501-121358523 ACCTGGGGGTTCTGATTCCCAGG - Intronic
1105043893 12:132986118-132986140 AACTGGGCGTCCAGGCTCCGAGG + Intergenic
1105205136 13:18216910-18216932 ACTTGGGAGTTCAGAATCCTGGG + Intergenic
1106226826 13:27792562-27792584 AGCCGCGCGTTCAGCCTCCTGGG + Intergenic
1111919421 13:94394878-94394900 TCCTGGATGTTCAGACTCCCAGG + Intronic
1118474621 14:66105147-66105169 ACATGTGAGTTCAGACTCCAGGG + Intergenic
1119644150 14:76336518-76336540 TCCTGGGCTTTCAGACCCCCTGG + Intronic
1128569975 15:68726774-68726796 CCCTGGGTGTTCAGACCCCAAGG + Exonic
1131266811 15:90920337-90920359 AGCGAGGCCTTCAGACTCCTAGG - Exonic
1134627854 16:15735593-15735615 ACCTGGGGGTTCATTCTGCTGGG - Intronic
1135091627 16:19522274-19522296 ACCTGGGCGTTCAGACTCCTAGG + Intergenic
1138697279 16:58826340-58826362 ACCTGGGCATTCAGCCATCTAGG - Intergenic
1139307577 16:66000514-66000536 ACCTGCACAGTCAGACTCCTTGG + Intergenic
1139513559 16:67440694-67440716 GCCTGGGCTCACAGACTCCTGGG - Intronic
1142501362 17:335011-335033 AACTGAGGCTTCAGACTCCTAGG + Intronic
1143798873 17:9360991-9361013 ACCTTCGTGTTCAGACTCATGGG + Intronic
1146281956 17:31550299-31550321 ACCTGGGCTTCGAGACTCCAGGG + Intergenic
1147548698 17:41422749-41422771 CCCTGGCTGCTCAGACTCCTGGG - Intronic
1147550654 17:41439174-41439196 CCCTGGGCGCTCAAACTCCTGGG - Intronic
1150387719 17:64774351-64774373 ACCTGGGCCTTCCCACTTCTGGG + Intergenic
1150576429 17:66434675-66434697 ACCTGGGCAATCTGACTCCAAGG - Intronic
1150897784 17:69234213-69234235 ACATGGAAGTTCAGACTCCCAGG + Intronic
1151334700 17:73433073-73433095 TCCTGGGCTTTCGGACTCCCAGG + Intronic
1153147289 18:2047815-2047837 TTCTGAGCTTTCAGACTCCTTGG - Intergenic
1157409024 18:47448233-47448255 AACTTGGAGTTCAGAATCCTAGG + Intergenic
1159015591 18:63099638-63099660 ACCTGGGCCGTCAGAGTCCAGGG + Intergenic
1160078824 18:75703868-75703890 ACCTGGGAATTCAGAGACCTGGG + Intergenic
1160078850 18:75703980-75704002 ACCTGGGGATTCAGAGCCCTGGG + Intergenic
1160078903 18:75704188-75704210 ACCTGGGGGTACAGAGACCTGGG + Intergenic
1163364422 19:16868237-16868259 GGCTGAGCGTGCAGACTCCTAGG + Intronic
1163605753 19:18274420-18274442 GACTGGCCGTTCAGACTGCTAGG - Exonic
1165150538 19:33757765-33757787 ACATGGGAGCTCAAACTCCTGGG + Intronic
1166306175 19:41938230-41938252 AGCTGGGGTTTTAGACTCCTGGG - Intergenic
1166388669 19:42396769-42396791 ATTTGAGAGTTCAGACTCCTTGG - Intergenic
1167352234 19:48982621-48982643 AGCTGGGGGCCCAGACTCCTGGG - Intronic
1167354358 19:48994024-48994046 ATCTGGGGGTTCAGACTCCTGGG + Intronic
1167432684 19:49463122-49463144 GGCTGGGGGTCCAGACTCCTGGG + Intronic
1167432709 19:49463196-49463218 GGCTGGGGGTCCAGACTCCTGGG + Intronic
1167432804 19:49463451-49463473 GGCTGGGGGTCCAGACTCCTGGG + Intronic
1167432872 19:49463632-49463654 GGCTGGGGGTCCAGACTCCTGGG + Intronic
1167432899 19:49463706-49463728 GGCTGGGGGTCCAGACTCCTGGG + Intronic
1167557737 19:50206218-50206240 GGCTGGGGGCTCAGACTCCTGGG + Intronic
1167744135 19:51340944-51340966 ACCTGGGAGTTCAGGCTCCCAGG + Intronic
1167798776 19:51727070-51727092 AGCTGGGAGTTGAGACTCCTGGG - Intergenic
1168294791 19:55373296-55373318 AGCTGGGGGTCTAGACTCCTGGG - Intergenic
1168332961 19:55580409-55580431 AGCTGGGGATTGAGACTCCTGGG + Intronic
925766637 2:7242641-7242663 AAATGGGCGTTCAGTCTTCTTGG + Intergenic
926610680 2:14943716-14943738 ACCTAGGTGTTCAGATTCTTAGG + Intergenic
927148284 2:20180860-20180882 ACCTGGGCACCCAGACTCCTAGG - Intergenic
929446027 2:42002061-42002083 CCCTGGGCCTACAGACCCCTGGG - Intergenic
931777640 2:65554084-65554106 ACCTCGATGTGCAGACTCCTTGG - Intergenic
937345193 2:121121098-121121120 ACCTCAGCGTTCAGCCTGCTTGG - Intergenic
939547373 2:143569936-143569958 ACCTAGGCTTTCTAACTCCTGGG - Intronic
939936901 2:148304094-148304116 TCCTGAGATTTCAGACTCCTAGG - Intronic
940110665 2:150148901-150148923 TCCTAGGCATTCACACTCCTAGG - Intergenic
941368728 2:164637812-164637834 ACCTGGGAGTTCAAGCTTCTTGG + Intergenic
941983041 2:171480736-171480758 ATCTGGGTATTTAGACTCCTGGG + Intronic
945296940 2:208179793-208179815 ACCTGGGAGTTCAGAGACCTGGG - Intronic
1171244566 20:23601081-23601103 ACCTAGTGGTTCAGATTCCTGGG + Intergenic
1173479793 20:43389966-43389988 ACCTGGGCTTACTGACTCCCTGG + Intergenic
1180829095 22:18889074-18889096 ACTTGGGAGGTCAGAATCCTGGG - Intergenic
1181960061 22:26616405-26616427 TCCTGTGCTTTCAGCCTCCTTGG + Intronic
1203279186 22_KI270734v1_random:115061-115083 ACTTGGGAGGTCAGAATCCTGGG - Intergenic
949221282 3:1636996-1637018 ACCTGGGCCTCCAGAGTGCTGGG - Intergenic
949944385 3:9178636-9178658 ACCTGGGCCTGTAGACTCCCAGG + Intronic
961857815 3:129890649-129890671 ATCTGGGCCTTCAGACTGTTTGG - Intronic
962317485 3:134367786-134367808 ACCTGGGCCTGCAGGATCCTGGG + Exonic
966847758 3:184143809-184143831 ACCTGGACATTCAGACTCTATGG + Intronic
968189723 3:196659179-196659201 AACTGGGCATTCAGAGCCCTGGG + Intronic
968986695 4:3879551-3879573 ACCTGTGAGTTCTGACTCCTCGG - Intergenic
969929235 4:10613965-10613987 GCCTGGGCATTCAGGGTCCTTGG - Intronic
975667079 4:76742672-76742694 AGCTGAGCATTCTGACTCCTAGG + Intronic
981806964 4:148727880-148727902 CCTTGGGCTTTCAGAGTCCTGGG + Intergenic
983963193 4:173778831-173778853 ATCTGGATTTTCAGACTCCTAGG + Intergenic
986463209 5:7994509-7994531 ACCTGGGCGTTCCCATTTCTGGG - Intergenic
989414181 5:41154139-41154161 ACCTGGGGGATAAGAATCCTGGG + Intronic
990300633 5:54446081-54446103 TCTTGGGCCTTCAGACTCCTTGG + Intergenic
996925693 5:128823761-128823783 ATCTGGGAGCTGAGACTCCTTGG - Intronic
1003014122 6:2454344-2454366 ACGTGGGCGTTCTGACACATGGG - Intergenic
1004381251 6:15134475-15134497 ACCTGGGCTTCCTGATTCCTGGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007370908 6:41426766-41426788 ACCTCGCAGTTCAGCCTCCTGGG + Intergenic
1012079249 6:94735491-94735513 CCCTGGGCTTTCAGGCTCCCCGG - Intergenic
1018374737 6:163200458-163200480 CCCTTGGCGTTTAGACTCCAAGG - Intronic
1019727159 7:2609393-2609415 ACCTCGGCCTCCAGAGTCCTGGG + Intronic
1021749332 7:23779597-23779619 ACCAGGAAGTTCAGACTCCACGG - Intronic
1022369501 7:29757508-29757530 GCCTGTGCGTTCAAACTGCTTGG - Intergenic
1029205111 7:98865178-98865200 ACCTGGGTGAACAGTCTCCTGGG - Intronic
1038576436 8:28707895-28707917 TCCTGGGAGTTGAGACTTCTGGG + Intronic
1045348462 8:101316234-101316256 AGCTGGGCTTTCATGCTCCTGGG - Intergenic
1047371045 8:124256409-124256431 ACCCGGGCCTTCTGACTCCCTGG + Intergenic
1052405545 9:28055378-28055400 GCCTGGCCATTCAGACTCCTTGG - Intronic
1057917581 9:99068820-99068842 ACCTGGGTCTTCTGACTCCAAGG - Intronic
1057945866 9:99327635-99327657 ACCTGGGGCCTCAGTCTCCTGGG - Intergenic
1061417207 9:130453577-130453599 AGCTGGGCGTATAGACCCCTGGG + Intronic
1189544669 X:42029219-42029241 AGCTGGGCTTTGATACTCCTAGG - Intergenic
1190129662 X:47735352-47735374 TCTTGGGCCTTCAGACTCCAGGG - Intergenic
1194157211 X:90405270-90405292 AGCAGGGAGGTCAGACTCCTGGG + Intergenic
1198051083 X:132954234-132954256 GCCTGGGAGTTCAGACAGCTGGG - Intronic
1198662296 X:138982723-138982745 ACCTTGGCCTTCTGATTCCTTGG - Intronic
1200503543 Y:3982253-3982275 AGCAGGGAGGTCAGACTCCTGGG + Intergenic
1201708723 Y:16966013-16966035 CCCTGGGAGTTGATACTCCTGGG - Intergenic