ID: 1135092654

View in Genome Browser
Species Human (GRCh38)
Location 16:19531670-19531692
Sequence TAAGATACTGAAGATGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135092650_1135092654 -5 Left 1135092650 16:19531652-19531674 CCAGTTGATCCAGTGAAATAAGA No data
Right 1135092654 16:19531670-19531692 TAAGATACTGAAGATGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135092654 Original CRISPR TAAGATACTGAAGATGGGCC AGG Intronic
No off target data available for this crispr