ID: 1135094790

View in Genome Browser
Species Human (GRCh38)
Location 16:19555908-19555930
Sequence CTGGCTTCAGATTGCTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135094790_1135094794 -7 Left 1135094790 16:19555908-19555930 CCAGCGGAGCAATCTGAAGCCAG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1135094794 16:19555924-19555946 AAGCCAGACTGGCGGGTTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135094790 Original CRISPR CTGGCTTCAGATTGCTCCGC TGG (reversed) Intronic
903948415 1:26979141-26979163 CTGGCTTGAGAGTGCTCAGAGGG + Intergenic
904628575 1:31824036-31824058 CTTGCTAGGGATTGCTCCGCTGG + Intergenic
906291165 1:44620027-44620049 TGGGCTTCAGTTTGCTCTGCTGG - Intronic
907949139 1:59164093-59164115 CTGGCCTCAGGTTCCTCAGCAGG + Intergenic
908888825 1:68819372-68819394 CTGGATTCAGGCTGCTCCTCGGG + Intergenic
910439577 1:87238929-87238951 CTGCATTCAGATTGCTTCACAGG - Intergenic
915639254 1:157209615-157209637 CTGGCTTCAGACTTCTTCTCTGG + Intergenic
915658897 1:157384562-157384584 CTGGCTTCAGATTTCTTCCCTGG + Intergenic
915876520 1:159616641-159616663 TTGACTTCAGACTGCTCTGCTGG - Intergenic
921778067 1:219126008-219126030 CTGGCTTCAGATGGCTCATTTGG - Intergenic
923428368 1:233894468-233894490 CTGGCTTCATTTTGCTTAGCTGG - Intergenic
1065120997 10:22530349-22530371 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG + Intergenic
1070770562 10:79079972-79079994 GTGTCTTCAGATTGCCCGGCTGG + Intronic
1072313458 10:94179447-94179469 CTGGCTTGAGGTTGCACAGCTGG - Intronic
1072741183 10:97910922-97910944 CTGAATTCACATTGCTCCTCTGG + Intronic
1073093710 10:100967487-100967509 CTGACTTCAGATAGCTCTGGAGG - Intergenic
1076310851 10:129506516-129506538 CTGGCTCCAGATTGTTCTCCAGG + Intronic
1079954646 11:26847935-26847957 GTGGCTATAAATTGCTCCGCAGG + Intergenic
1083499172 11:63087693-63087715 CAGGCTTCAGACTACTGCGCTGG - Intronic
1083849206 11:65355364-65355386 CTGGATTCAGATGACGCCGCTGG - Intronic
1084755497 11:71235961-71235983 CTGGCCTCAGTTTTCTCAGCAGG - Intronic
1086129195 11:83383236-83383258 TTGGCTTCAGACTGCTGTGCTGG - Intergenic
1086300342 11:85420809-85420831 TTGACTTCAGACTGCTCTGCTGG + Intronic
1091463478 12:663691-663713 GTGACCTCAGATGGCTCCGCTGG - Exonic
1091575198 12:1727548-1727570 GTGGCTTCAGATTCCTCTGGAGG - Intronic
1093610524 12:21149968-21149990 TTGACTTCAGACTGCTCGGCTGG - Intronic
1094061086 12:26316180-26316202 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1095674236 12:44897883-44897905 TTGGCTTCAGACTGCTGGGCTGG - Intronic
1096164200 12:49407410-49407432 CTGGCTTCAGTTTACTCCTCTGG + Intronic
1101820804 12:108183001-108183023 CTGGATTCAGATGGGTCCACAGG + Intronic
1103926966 12:124428599-124428621 CTGGCTGCAGAGTGCTCTGTTGG - Intronic
1104115604 12:125746419-125746441 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1104173841 12:126309715-126309737 CTGGCTTCAGTTTACTCTTCTGG + Intergenic
1105800761 13:23901315-23901337 CTGGCCTCAGATGACTCCACAGG + Intronic
1107399742 13:40057670-40057692 CAGGCTTCAGATTGAACCACAGG + Intergenic
1107778787 13:43877135-43877157 CTGCCCTCAGATTGCTTCACAGG + Intronic
1112388222 13:98959744-98959766 CTGTCTTCAGTTTCCTCCCCAGG - Intronic
1117100354 14:52339756-52339778 CTGGCTTCAGTGGGCTCCTCAGG - Intergenic
1117859366 14:60073751-60073773 TTGACTTCAGATTGCTGTGCTGG - Intergenic
1119148051 14:72334094-72334116 CTGGCTTCAGAATTCTCCTGAGG - Intronic
1119897444 14:78232077-78232099 CTGGCATCACATTGCTCTGCAGG + Intergenic
1121218936 14:92271384-92271406 ATGGCTTCATCTTGCTCCCCAGG + Intergenic
1121239287 14:92416423-92416445 CTGGCCTCAGTTTCCTCCTCAGG - Intronic
1128113392 15:65090424-65090446 CTGCCTTCAGCCTGCTCCACTGG + Intergenic
1132319354 15:100914167-100914189 CTGGCCTCAGAGTGCACAGCTGG - Intronic
1135094790 16:19555908-19555930 CTGGCTTCAGATTGCTCCGCTGG - Intronic
1136140278 16:28283889-28283911 CTGGCCTCAGCCTGCTCTGCTGG + Intergenic
1139431960 16:66915526-66915548 TTGGCTTCAGTTTGCTCATCTGG - Intronic
1140778139 16:78269131-78269153 CTGGCTTCAAGCTGCTCCTCTGG - Intronic
1145991148 17:29080207-29080229 CGGGCTCCAGGCTGCTCCGCTGG + Intronic
1146277318 17:31523952-31523974 CTTGCTTCAGCTTGCTCTTCAGG - Exonic
1147511253 17:41070662-41070684 CTGGCTTCACATTGCTACCATGG + Intergenic
1149554070 17:57560577-57560599 CTGGCCTAAGGTTGCTCAGCTGG - Intronic
1151759331 17:76091628-76091650 CTGGCTTCAGGGTGCCCCCCAGG - Intronic
1152787090 17:82254186-82254208 CTGGCTTCACAAGGCTCCGGCGG - Intronic
1152889256 17:82871050-82871072 CTGGCTTCAGTTTTCTCATCAGG - Intronic
1155857345 18:30850146-30850168 TTGACTTCAGACTGCTCTGCTGG + Intergenic
1157178875 18:45477857-45477879 CTGACTTCAGACTGCTGTGCTGG + Intronic
1157571755 18:48716929-48716951 CTAGTGTCAGATGGCTCCGCAGG + Intronic
1158008797 18:52704745-52704767 CTGGATTCAGATGGCTCCAGTGG + Intronic
1159228481 18:65572860-65572882 CTGCCTTCAGATAGCCCAGCAGG + Intergenic
1160182595 18:76648207-76648229 CTGGCTCCATGTTGCTCCCCGGG + Intergenic
1160228897 18:77031813-77031835 CTGGCTGCAGAGTGGGCCGCAGG + Intronic
1160318660 18:77870234-77870256 AGGGCATCAGCTTGCTCCGCAGG - Intergenic
1165144176 19:33720998-33721020 CTGTCTTCAGCTTGCACCTCTGG + Intronic
926571577 2:14535366-14535388 CTGGCTTAAGGTTGCTTCACAGG - Intergenic
928042979 2:27896812-27896834 CTGGGTCCACATTGCTCAGCTGG + Intronic
935461532 2:103341532-103341554 CTGCCCTCAGATTGCTTGGCAGG + Intergenic
939688493 2:145228373-145228395 CTGGTTTCTCATTGCTCTGCAGG + Intergenic
939937768 2:148313514-148313536 TTGACTTCAGACTGCTCTGCTGG + Intronic
940562921 2:155324411-155324433 CAGGCTTCAGATTCCTCCAGTGG - Intergenic
948725847 2:239933416-239933438 CTGGCTCCAGGTCGCTCCCCAGG - Intronic
1174266739 20:49337490-49337512 CTGGGTTCAGATTCCACCTCTGG + Intergenic
1175819678 20:61902063-61902085 CTGGCTCCAGGCTGCTCCTCAGG - Intronic
1176300436 21:5096559-5096581 ATGCCTTCAGATTCCTCCGCTGG + Intergenic
1179856608 21:44165422-44165444 ATGCCTTCAGATTCCTCCGCTGG - Intergenic
1180182056 21:46122474-46122496 CTGGCTTCTGTTTGCTTCACAGG + Exonic
1182892620 22:33831557-33831579 GTGGCTTGAGAGTGCTCCTCTGG - Intronic
1183014317 22:34973357-34973379 CTGGCTTTAGCTTGCTCCTGGGG - Intergenic
1185216578 22:49603283-49603305 CGGGCTTCAGAATGGTCTGCGGG + Intronic
950871386 3:16232695-16232717 CTGGCTCCAGTTTGTTCCCCAGG + Intergenic
950951322 3:17003350-17003372 CTGGCTTCAAATTTCTCCACTGG + Intronic
951002700 3:17582247-17582269 CTGGCTTCAAATTTCTCAGGAGG + Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
956097817 3:65735986-65736008 GTGGGTTCAGATTGCTGCTCGGG - Intronic
956645014 3:71446805-71446827 CTGGCTGCACATTCCTCAGCAGG + Intronic
957850445 3:85800259-85800281 TTGACTTCAGACTGCTCTGCTGG + Intronic
959539237 3:107521949-107521971 CTTGCTCAAGATTGCTCAGCTGG + Intergenic
962009652 3:131381299-131381321 CTGACTCCAGATTGCGACGCAGG + Intergenic
962392308 3:134983472-134983494 CTGGGTTCAGACTCATCCGCTGG + Intronic
963354081 3:144188419-144188441 ATGGCTCCAGATTGCTCTGTGGG + Intergenic
968551740 4:1226825-1226847 CTGGCTTCAGCTGCTTCCGCCGG - Intronic
970437735 4:16051745-16051767 CTGGTTCCAGTTTGCTCGGCTGG - Intronic
973629101 4:52802225-52802247 TTGGCTTCAGACTGCTGTGCTGG - Intergenic
974946628 4:68536267-68536289 TTGACTTCAGATTGCTGTGCTGG + Intergenic
978108266 4:104930826-104930848 TTGACTTCAGACTGCTCTGCTGG - Intergenic
978313276 4:107409557-107409579 TTGACTTCAGATTGCTGTGCTGG - Intergenic
979043678 4:115834524-115834546 CTGACTTCAGACTGCTGCGCTGG - Intergenic
982173486 4:152683636-152683658 CTGGCTTCAGAGTGATACACAGG - Intergenic
982548224 4:156761087-156761109 CTGTCTTCAGACTGCTCTTCAGG - Exonic
986611770 5:9575554-9575576 CTGGCTTCTTACTGCTCAGCCGG + Intergenic
987281509 5:16418673-16418695 CTGGCTTCTGAGTGCTTAGCAGG - Intergenic
990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG + Intergenic
993757629 5:91751086-91751108 TTGACTTCAGACTGCTCTGCTGG + Intergenic
995301914 5:110594573-110594595 CTGCCTTCAGACTGCTGTGCTGG - Intronic
999141367 5:149364571-149364593 CTGGCTGCAGATGGCTGCGGTGG - Intronic
1002598086 5:180337119-180337141 GTGGCTACACAATGCTCCGCTGG - Intronic
1006403406 6:33830769-33830791 CAGGCTTCAGATTCCCTCGCAGG - Intergenic
1007146382 6:39637822-39637844 CTGGCTTTAAATTGCTCCAATGG + Intronic
1011091075 6:83600555-83600577 CTGGCTTCACATGGCTCATCAGG + Intronic
1016241864 6:141940363-141940385 TTGACTTCAGATTGCTGTGCTGG - Intergenic
1016908359 6:149173235-149173257 CTGACCTCAGCTTGCTCAGCTGG - Intergenic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1020079384 7:5279012-5279034 GTGACTTCAGATTTCTCTGCAGG + Intronic
1025199511 7:56953187-56953209 GTGACTTCAGATTTCTCTGCAGG - Intergenic
1025672435 7:63623743-63623765 GTGACTTCAGATTTCTCTGCAGG + Intergenic
1031450936 7:121917000-121917022 GTGGCTTCACATTCCTCTGCTGG - Intronic
1031613776 7:123857058-123857080 TTGACTTCAGATTGCTGTGCTGG + Intronic
1041481972 8:58332005-58332027 CTGACTCCAGACTGCTGCGCTGG - Intergenic
1043036675 8:75208196-75208218 CTGACTTCAGACTGCTGTGCTGG + Intergenic
1046067989 8:109218883-109218905 GTGACTTCAGATTGCTGGGCTGG + Intergenic
1052061554 9:23966525-23966547 GTGACTTCAGATTGCTGAGCTGG + Intergenic
1058905025 9:109475853-109475875 CTGGCTTCAGACTCCTTGGCGGG - Intronic
1059256078 9:112932117-112932139 CTGACTCCAGATTGCTCTGCAGG + Intergenic
1059283781 9:113155859-113155881 CTGGCCTCAGTTTCCTCCGAGGG - Intronic
1189657932 X:43266841-43266863 CTGGCTTCACATGGCACCTCTGG - Intergenic
1191928702 X:66344537-66344559 TTGGCTTCAGACTGCTGTGCTGG + Intergenic
1192707404 X:73541155-73541177 TTGGCTTCAGACTGCTATGCTGG - Intergenic
1192938021 X:75881523-75881545 TTGACTTCAGACTGCTCTGCTGG + Intergenic
1195672968 X:107484578-107484600 CTGGCTCCAGCTGGCTCCCCTGG + Intergenic
1195820878 X:108944253-108944275 TTGACTTCAGACTGCTGCGCTGG + Intergenic
1196281179 X:113825389-113825411 TTGGCTTCAGATGGCTGTGCTGG + Intergenic
1198338465 X:135690953-135690975 CTGGCTCCAGATTGATACACTGG - Intergenic