ID: 1135097637

View in Genome Browser
Species Human (GRCh38)
Location 16:19577788-19577810
Sequence CTGTGTTTTCACTTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135097637_1135097648 26 Left 1135097637 16:19577788-19577810 CCTTCCACCAAGTGAAAACACAG No data
Right 1135097648 16:19577837-19577859 CCGGAAAGCAGGCTGTCATCAGG No data
1135097637_1135097643 7 Left 1135097637 16:19577788-19577810 CCTTCCACCAAGTGAAAACACAG No data
Right 1135097643 16:19577818-19577840 GCATCATCTATGAACCCAACCGG No data
1135097637_1135097644 15 Left 1135097637 16:19577788-19577810 CCTTCCACCAAGTGAAAACACAG No data
Right 1135097644 16:19577826-19577848 TATGAACCCAACCGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135097637 Original CRISPR CTGTGTTTTCACTTGGTGGA AGG (reversed) Intronic
No off target data available for this crispr