ID: 1135106868

View in Genome Browser
Species Human (GRCh38)
Location 16:19657419-19657441
Sequence GTTTATCTGCAGAAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135106868_1135106872 -7 Left 1135106868 16:19657419-19657441 CCTTCCCATTTCTGCAGATAAAC No data
Right 1135106872 16:19657435-19657457 GATAAACAGAAAGTTAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135106868 Original CRISPR GTTTATCTGCAGAAATGGGA AGG (reversed) Intronic
No off target data available for this crispr