ID: 1135109214

View in Genome Browser
Species Human (GRCh38)
Location 16:19677661-19677683
Sequence TGTCTGTCTCACCAGCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135109214_1135109216 1 Left 1135109214 16:19677661-19677683 CCGAGCTGCTGGTGAGACAGACA No data
Right 1135109216 16:19677685-19677707 GACTGAGAGAAACAGCAAGCTGG No data
1135109214_1135109217 26 Left 1135109214 16:19677661-19677683 CCGAGCTGCTGGTGAGACAGACA No data
Right 1135109217 16:19677710-19677732 TCTGACAGCTTCCCGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135109214 Original CRISPR TGTCTGTCTCACCAGCAGCT CGG (reversed) Intronic
No off target data available for this crispr