ID: 1135109217

View in Genome Browser
Species Human (GRCh38)
Location 16:19677710-19677732
Sequence TCTGACAGCTTCCCGTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135109214_1135109217 26 Left 1135109214 16:19677661-19677683 CCGAGCTGCTGGTGAGACAGACA No data
Right 1135109217 16:19677710-19677732 TCTGACAGCTTCCCGTCAAGTGG No data
1135109213_1135109217 27 Left 1135109213 16:19677660-19677682 CCCGAGCTGCTGGTGAGACAGAC No data
Right 1135109217 16:19677710-19677732 TCTGACAGCTTCCCGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135109217 Original CRISPR TCTGACAGCTTCCCGTCAAG TGG Intronic