ID: 1135109333

View in Genome Browser
Species Human (GRCh38)
Location 16:19678446-19678468
Sequence CAGTGCCAACAGCTGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135109333_1135109335 11 Left 1135109333 16:19678446-19678468 CCTTACTTCAGCTGTTGGCACTG No data
Right 1135109335 16:19678480-19678502 CATTTTTTTTTTTTTTTGAGAGG 0: 13
1: 296
2: 2899
3: 7633
4: 35823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135109333 Original CRISPR CAGTGCCAACAGCTGAAGTA AGG (reversed) Intronic
No off target data available for this crispr