ID: 1135112288

View in Genome Browser
Species Human (GRCh38)
Location 16:19699620-19699642
Sequence GGCACGGCTGTGCAGACACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135112285_1135112288 -3 Left 1135112285 16:19699600-19699622 CCTGTGGCACCTGGCACAGAGGC 0: 1
1: 0
2: 5
3: 43
4: 355
Right 1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG 0: 1
1: 0
2: 1
3: 16
4: 186
1135112283_1135112288 4 Left 1135112283 16:19699593-19699615 CCGTCAACCTGTGGCACCTGGCA 0: 1
1: 0
2: 21
3: 101
4: 436
Right 1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG 0: 1
1: 0
2: 1
3: 16
4: 186
1135112281_1135112288 12 Left 1135112281 16:19699585-19699607 CCAGCTCTCCGTCAACCTGTGGC 0: 1
1: 0
2: 0
3: 10
4: 152
Right 1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135112288 Original CRISPR GGCACGGCTGTGCAGACACC AGG Exonic
900184925 1:1328513-1328535 GGCTGGGCTGTGCAGACCCACGG - Exonic
900477236 1:2881711-2881733 GGCACGGAGCTGCAGACCCCAGG + Intergenic
902100777 1:13986802-13986824 GGCACTGCTGTCTAGACACGAGG - Intergenic
902219972 1:14958625-14958647 GGCACAGCTTTGGAGTCACCAGG - Intronic
902435478 1:16395821-16395843 GGCAGGGCTCTGCAGCCGCCAGG + Exonic
902840805 1:19072633-19072655 AGCACCCCTGTGCAGACACTAGG + Intergenic
904190767 1:28741745-28741767 GGAACGGCTGTACAGACATTTGG + Intronic
904330476 1:29755138-29755160 AGCAGGGCTGTGCAGAAAGCTGG + Intergenic
904416203 1:30362456-30362478 AGCAGGGCTGTGCAGAAAGCTGG - Intergenic
905792449 1:40797497-40797519 GGCTCGGCAGTGAGGACACCGGG + Intronic
909519079 1:76546603-76546625 GGCAAGGCAGTGAATACACCTGG + Intronic
910502323 1:87907040-87907062 AGCATGGCTCTGCTGACACCTGG - Intergenic
915172970 1:153990987-153991009 GGCCCAGCTGCGCAGACACCAGG + Intronic
915973009 1:160367180-160367202 GGCATGGCTGTACAGGCTCCAGG - Exonic
917537978 1:175888183-175888205 GGGGAGGCTGTGCAGGCACCGGG + Intergenic
920356996 1:205381099-205381121 GGCAGAGCTGTGTAGGCACCCGG - Intergenic
921344537 1:214168714-214168736 GGCATGGCTGCGGAGCCACCGGG - Intergenic
923116187 1:230940463-230940485 AGCACGGCTGTACAGACATCGGG - Exonic
923495626 1:234521971-234521993 GGCACGGCTGGGCAGACTGTGGG - Intergenic
923546735 1:234928797-234928819 GGCACAGGTGTGCACACACCTGG + Intergenic
1062760194 10:11846-11868 GGGACGGCTGCGCAGCCGCCAGG - Intergenic
1062960211 10:1567644-1567666 GGTAGGGCTGTGGAGGCACCTGG - Intronic
1064276049 10:13905997-13906019 AGCAGAGCTCTGCAGACACCTGG + Intronic
1070139401 10:73726973-73726995 GGCAAGGATGTGCATGCACCTGG + Intergenic
1072631215 10:97147857-97147879 GGAGCAGCTGTGCAGACACAGGG - Intronic
1073759129 10:106611750-106611772 GGCTCAGCTTTGCAGACATCAGG + Intronic
1073929155 10:108554691-108554713 GGCACTGCTGTAGAGATACCGGG + Intergenic
1074778356 10:116783035-116783057 GGAAAGGCTGTGGAGAGACCTGG - Intergenic
1075341701 10:121651449-121651471 GGCACTGCAGAGCAGGCACCTGG - Intergenic
1076246743 10:128952816-128952838 AGGACGGCTCTGCAGACACCTGG + Intergenic
1077165053 11:1131116-1131138 GGCAGGGCTGTCTAGACAGCGGG - Intergenic
1077243952 11:1526878-1526900 AGCACAGCCGGGCAGACACCAGG + Intergenic
1077375090 11:2202042-2202064 GGCAGGGCCTGGCAGACACCTGG - Intergenic
1077378986 11:2219404-2219426 GGCAGGGCTGTCCAGAGTCCTGG - Intergenic
1077535341 11:3121473-3121495 GCCTGGGCTCTGCAGACACCAGG + Intronic
1078067581 11:8088557-8088579 GGCACGCCTGTGCAGGAACCTGG + Intronic
1080167119 11:29252017-29252039 GGCATGGCTATGGAGGCACCAGG - Intergenic
1084219308 11:67667704-67667726 GGCAAGGGTGTGCAGACCCTGGG - Intronic
1084752466 11:71213262-71213284 GGCACAGCTGTGCAGGCTGCTGG - Intronic
1085120037 11:73961552-73961574 GGCACTGTTGTGGAGACACTAGG - Intronic
1089452676 11:118608522-118608544 GGCAGGGCTGTGCGGTCGCCCGG - Intronic
1092618451 12:10236930-10236952 GTCAGGGCTGTGCACATACCTGG + Intergenic
1093210828 12:16306399-16306421 GGCAAGGCTGTGGAGAAACAGGG - Intergenic
1093434288 12:19118099-19118121 GGAATGGCAGAGCAGACACCTGG - Intergenic
1096705742 12:53420876-53420898 GGCAAGGCCCTGCAGACTCCTGG + Intergenic
1100109856 12:91227124-91227146 GTCACAGCTTTGCAGACAGCAGG - Intergenic
1101858582 12:108464276-108464298 GAGCTGGCTGTGCAGACACCTGG - Intergenic
1103893071 12:124254359-124254381 GGCAAAGCTGTGCTGACACTGGG + Intronic
1104580919 12:130010117-130010139 GCGAGGGCTGAGCAGACACCGGG - Intergenic
1104881616 12:132075250-132075272 GACACAGCTGACCAGACACCAGG - Intronic
1105780527 13:23702005-23702027 GCCATGGCTGTGGGGACACCTGG + Intergenic
1106485862 13:30171962-30171984 GGCCCGGCAGTCCAGACTCCAGG + Intergenic
1108267806 13:48730014-48730036 GGCAAGGGTGTGCAAACAGCAGG - Intergenic
1112601418 13:100859113-100859135 GGCATTGCCGTGCCGACACCTGG + Intergenic
1113806934 13:113115444-113115466 GGCAAGGCTGTTCAGACATGTGG + Intronic
1118312811 14:64705608-64705630 GGCACGGCTGGGGAGACTCTGGG - Intronic
1121308377 14:92921716-92921738 GGGACGGCTGTGCTGAGACAGGG - Intergenic
1122548422 14:102537564-102537586 GGGAAGGATGTGCACACACCAGG - Intergenic
1122800030 14:104224851-104224873 CACAGGGCTGTACAGACACCTGG + Intergenic
1123008523 14:105335943-105335965 AGGATGGCTGTGCAGGCACCTGG + Intronic
1123062127 14:105599187-105599209 GGCACAGCTGTGCACACACTAGG - Intergenic
1123086874 14:105720915-105720937 GGCACAGCTGTGCACACACTAGG - Intergenic
1124251734 15:28110797-28110819 GCCAAGGCTGTGCAGACAGATGG + Intergenic
1128452032 15:67811342-67811364 GGCCTGAGTGTGCAGACACCTGG - Intergenic
1130381055 15:83372760-83372782 GGCAAGGCAGGGCAGACACGTGG - Intergenic
1130485735 15:84397405-84397427 GGCACGAGTGTGCAGGCAGCTGG - Intergenic
1131374179 15:91909949-91909971 GGCACTGCTGTGCAGGTATCAGG - Intronic
1131880662 15:96858850-96858872 GACACAGCTGTGCAGGCCCCAGG - Intergenic
1132305365 15:100807977-100807999 GCCACAGCTGAGCAGACATCAGG + Intergenic
1133100145 16:3474522-3474544 GGGAAGGTTGTGCAGAAACCTGG + Intronic
1134341509 16:13351018-13351040 GGCACTGATGTGCAGGCACTGGG + Intergenic
1135112288 16:19699620-19699642 GGCACGGCTGTGCAGACACCAGG + Exonic
1136569911 16:31090588-31090610 GGGAAGGCTGAGCACACACCTGG - Intronic
1136683877 16:31983096-31983118 GGCACTTCTGTGCAGGCTCCTGG - Intergenic
1136784506 16:32926648-32926670 GGCACTTCTGTGCAGGCTCCTGG - Intergenic
1136885277 16:33927158-33927180 GGCACTTCTGTGCAGGCTCCTGG + Intergenic
1141882971 16:86872098-86872120 GGTACGGCTCTGCAGGCAGCTGG - Intergenic
1142130303 16:88429034-88429056 GGCACTGCTGGCAAGACACCGGG + Exonic
1142273302 16:89102318-89102340 GGAGTGGCTCTGCAGACACCAGG - Intronic
1142281299 16:89149312-89149334 GGCACTGCTGTTAAGACATCTGG - Intronic
1203087165 16_KI270728v1_random:1190654-1190676 GGCACTTCTGTGCAGGCTCCTGG - Intergenic
1143014296 17:3883503-3883525 GTCACTACTGTGCAGCCACCAGG + Intronic
1144025668 17:11274115-11274137 GCCAAGCCTGTGCAGCCACCAGG - Intronic
1145774676 17:27519601-27519623 GGCTGGGCTGTGCAGAGAACGGG - Intronic
1145898686 17:28475767-28475789 GGCAGGGCTGGGCAGGAACCAGG - Intronic
1148841558 17:50501955-50501977 AACACAGCTCTGCAGACACCTGG - Intergenic
1150029549 17:61718534-61718556 GGGACGCCTATGCAGATACCTGG + Intronic
1151715484 17:75828961-75828983 GGCACGGCTCAGCAGGCACCAGG + Exonic
1152036190 17:77874566-77874588 GGCGGGGCAGTGCAGAAACCCGG - Intergenic
1152049306 17:77959467-77959489 GACGGGGCTGTGCAGACGCCCGG + Intergenic
1152068044 17:78122155-78122177 GGCCCGGCTCTGCAGCCTCCTGG + Intronic
1152553078 17:81039523-81039545 GGCAAGGCTGTGGGGACAGCAGG - Intronic
1152690265 17:81714816-81714838 GGCACGGGTGTGGAGTCCCCGGG + Intronic
1152953102 18:12200-12222 GGGACGGCTGCGCAGCCGCCAGG - Intergenic
1154107381 18:11534265-11534287 GGCACGGCTGGGCAGTGGCCAGG + Intergenic
1155252372 18:23964746-23964768 GGCAGGGCTGTGCAGGAGCCAGG + Intergenic
1158453435 18:57586670-57586692 GCCACTGCTGGGCGGACACCTGG - Intronic
1159838712 18:73371870-73371892 GGCACCGCTGTAAAGATACCCGG + Intergenic
1160561097 18:79756103-79756125 AGCACGGCTGTGCAGAGATGCGG - Exonic
1160892906 19:1388535-1388557 GGCCCGGCTGTGCAGGCACGAGG + Exonic
1161171143 19:2813033-2813055 GGCGAGGGTGTGCAGACTCCTGG + Intronic
1161421181 19:4176714-4176736 GGCATGGCCCTGCAGACACCTGG + Intronic
1161696701 19:5772748-5772770 GGCAGGGCTGTGCAGGGAGCAGG - Intronic
1162470424 19:10869660-10869682 TCCACGGGTGTGCAGAGACCTGG - Exonic
1163331305 19:16639862-16639884 TGCACGGCTGGGGAGACCCCAGG - Intronic
1166211990 19:41312651-41312673 AGCACGACCCTGCAGACACCTGG - Intronic
1166751285 19:45165067-45165089 GGCAGGGCTGGGCAGGCCCCGGG - Intronic
1167871838 19:52377144-52377166 GGCAGGTCTATGCAGACCCCAGG - Intronic
925597250 2:5568144-5568166 GGCAGGGCTGTGGAGACATTTGG - Intergenic
925603268 2:5630306-5630328 GGAACGGGTGTGCACACACATGG + Intergenic
927927702 2:27025076-27025098 GCCACCACTGTGCAGATACCTGG + Intronic
928314822 2:30236941-30236963 GGCAGGGCTGTGCAGTGAGCTGG + Intronic
937320276 2:120956751-120956773 TGCACGGCCCTGCAGGCACCAGG - Intronic
937335479 2:121059771-121059793 GTCAGGGCTGGGCAGGCACCTGG - Intergenic
937419330 2:121741212-121741234 GGCAGGGCTGGGCAGGCAGCAGG + Intronic
938071593 2:128311330-128311352 GGCACTTCTCTGCAGCCACCTGG - Intronic
938899802 2:135790374-135790396 GGCACTGCTGTTCCGACATCAGG + Intronic
941810230 2:169748287-169748309 GACGCAGCTGTGCAGAGACCTGG + Intronic
943049567 2:182898886-182898908 GGCAGGGGTGGGCAGAGACCTGG + Intergenic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
1171255692 20:23687743-23687765 GGCAGAGCTGTGGAGAAACCTGG + Intronic
1171263028 20:23749663-23749685 GGCAGAGCTGTGGAGAAACCTGG + Intronic
1173199921 20:40946853-40946875 GGCACGGCTGAGCACATCCCGGG + Intergenic
1173664287 20:44753906-44753928 ATAAAGGCTGTGCAGACACCAGG + Intronic
1175421131 20:58834445-58834467 GGTCCGGCTGGGCAGACAGCCGG + Intergenic
1176081860 20:63277533-63277555 GACACGGCTGTGTGCACACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1177327251 21:19607028-19607050 GGGACCGCAGTGCAGCCACCTGG + Intergenic
1178872655 21:36389151-36389173 AGCCCGGCACTGCAGACACCAGG - Intronic
1180168035 21:46040186-46040208 GGGACAGCTGTGCAGCCCCCGGG - Intergenic
1181463363 22:23098068-23098090 GGCCCATCTGTGAAGACACCTGG - Intronic
1181695114 22:24589077-24589099 GGGCCGACTGTGCAGAGACCTGG + Intronic
1181934593 22:26429525-26429547 GGCGCGGCTGGGCCGACCCCAGG + Intronic
1183704226 22:39467013-39467035 GGCACAGCTCTGCTGACATCAGG + Intronic
1184148859 22:42627207-42627229 AGCAGAGCTGTGCAGACCCCTGG + Intronic
1184969656 22:48006812-48006834 GGAACCGCAGTGGAGACACCTGG - Intergenic
1185030793 22:48441861-48441883 GACAAGTCTGTGCAGACACTAGG - Intergenic
951293067 3:20898487-20898509 GGCAAGGCTGTGAAAAAACCTGG + Intergenic
951334600 3:21406007-21406029 GTGAAGGCTGTGCGGACACCGGG - Intergenic
954648977 3:52148573-52148595 GCCAGTGCTGTGCAGACAGCGGG - Intronic
954839985 3:53502654-53502676 TGCATTGCTGTGCAGCCACCTGG + Intronic
960994247 3:123330630-123330652 GGGAGGGCTCTGCAGACTCCAGG - Intronic
962847091 3:139282353-139282375 GGCAGGGCTGGGCAGGCACAAGG - Intronic
962919792 3:139940136-139940158 GGCAAGGCTCTGGAGATACCAGG - Intronic
963601726 3:147384728-147384750 GGCACAGCTGTGAAGACTCCAGG + Intergenic
964674172 3:159258932-159258954 GGCACAGAAGTGAAGACACCAGG - Intronic
967746395 3:193060567-193060589 GGAACGCCAGTGCGGACACCAGG + Intergenic
968495480 4:913073-913095 GGCAATGCTCTGCAGACACGGGG + Intronic
968814418 4:2814645-2814667 GGCAGGGCTCTGGAGACACATGG - Intronic
973745844 4:53962702-53962724 GGGAGGCCTGTGCAGCCACCTGG - Intronic
985187429 4:187332630-187332652 GGCCAAGCTGTTCAGACACCTGG + Intergenic
985364833 4:189217550-189217572 AGGACGGCTGTGCAATCACCTGG + Intergenic
986013379 5:3737254-3737276 GACAAGGCTGTGCTGACACGTGG - Intergenic
986152343 5:5139777-5139799 GGCACAGCTGTGGGGACACTGGG - Intergenic
986316094 5:6587468-6587490 GACACTGCTGTGCTGACATCTGG - Intergenic
986476741 5:8142308-8142330 TGGACTGCTGGGCAGACACCAGG - Intergenic
987432443 5:17852679-17852701 GGCATGGCTGTATAGACTCCTGG - Intergenic
987470482 5:18321630-18321652 GTCCAGGCTGTGCAGACCCCTGG + Intergenic
988073819 5:26326370-26326392 GGCCAGGCTGTGAAAACACCTGG + Intergenic
990492319 5:56314690-56314712 GGCAGGGCTGTGCATGCATCCGG - Intergenic
990923462 5:60993789-60993811 GCCAGAGCTGAGCAGACACCAGG - Intronic
995841183 5:116444847-116444869 TGCGCGGTTGGGCAGACACCTGG - Exonic
996686445 5:126286755-126286777 GGCAAGGTTGTCCAGACAACTGG + Intergenic
999166236 5:149551566-149551588 GGCACGCCTGCGCAGTCAGCAGG - Intergenic
1002796219 6:473122-473144 GGCACACCTGTGCAGACATGCGG + Intergenic
1003452064 6:6244014-6244036 GGGAAGGCTGTGCAACCACCTGG - Intronic
1013278129 6:108606523-108606545 GGCAAGGCTGTGCAGACACTTGG - Intronic
1014205607 6:118651896-118651918 GGCACCTCTGTGAAGACACGTGG + Intronic
1015294053 6:131570129-131570151 AGCATGGCTCTGCCGACACCTGG + Intergenic
1017116639 6:150983618-150983640 GACATGGCTGTGCAGTCCCCAGG + Intronic
1019283431 7:211642-211664 GGCAGGGCTGTGCTGTCACCCGG + Intronic
1019542682 7:1558650-1558672 GGAATGGCTGTGCAGACAGCAGG + Intronic
1019943386 7:4308488-4308510 GGCGCAGCCCTGCAGACACCTGG - Intergenic
1024602256 7:50994272-50994294 GGCACGGGTGGGAAGAGACCGGG - Intergenic
1029283918 7:99453371-99453393 GGCACGGCTGCACCTACACCTGG - Intronic
1030988050 7:116265281-116265303 GCCAAGGCTGGGCAGCCACCAGG + Intergenic
1032307686 7:130752619-130752641 GGCAGAGCTGTCCAGCCACCAGG - Intergenic
1033737010 7:144232268-144232290 GGCTGGCCTGTGCTGACACCTGG - Exonic
1033746047 7:144318678-144318700 GGCTGGCCTGTGCTGACACCTGG + Exonic
1034069892 7:148174390-148174412 GGAACTGCTGTGCAGGCACCAGG - Intronic
1034727401 7:153350487-153350509 GACACTGCTGTGGGGACACCTGG + Intergenic
1034938151 7:155212863-155212885 GCCACGGCTCTGCAGGCATCTGG - Intergenic
1035606740 8:934372-934394 GAGACTGCTGTGGAGACACCTGG + Intergenic
1035759046 8:2055816-2055838 ATCACGGCTGTCCAGAGACCTGG - Intronic
1039345335 8:36697590-36697612 GGCACAACTGTCCAAACACCTGG - Intergenic
1039370656 8:36981025-36981047 GGCAAAGCTGTACAGACACCTGG - Intergenic
1039912550 8:41836445-41836467 AGCACGGCTGTGCTCACAGCAGG - Intronic
1048862920 8:138737098-138737120 GGCACAGCTCTGCAGGGACCTGG - Intronic
1049395461 8:142398191-142398213 GGCAGGGCTGGGTAGATACCTGG - Intronic
1052022584 9:23542009-23542031 GGCACAGCTGGGCAGCCCCCAGG - Intergenic
1053453548 9:38213310-38213332 GGAAAGGCTGTGCAGACACAAGG - Intergenic
1056548757 9:87634694-87634716 GGCACTGCCGAGCAGCCACCTGG - Intronic
1056880429 9:90386773-90386795 GGCATGGCTGGTCAGAGACCTGG + Intergenic
1057867183 9:98690899-98690921 GGCCTGGCTGTGCAGTCACAGGG - Intronic
1060050916 9:120377547-120377569 AGCACGGCCCTGCTGACACCTGG - Intergenic
1060149641 9:121280091-121280113 GGCAGGGCCGTGCAGGCTCCTGG - Intronic
1060798962 9:126531764-126531786 GGCAGGGCTGGGCAGGCACAGGG + Intergenic
1060993948 9:127865270-127865292 GGCAGGGCCCTGAAGACACCTGG - Intergenic
1060999749 9:127896520-127896542 GGCAGGGCTCTGCCGCCACCAGG - Intronic
1062287722 9:135780548-135780570 GGCCGGGCTGGGCAGCCACCAGG + Intronic
1185778538 X:2825722-2825744 CACAAGGCTGTGCAGACATCTGG + Intergenic
1187201089 X:17134315-17134337 GGCATGGCTGGGCAGATGCCAGG - Intronic
1193012424 X:76691641-76691663 GGCACGGCTGTGGAGGCCTCAGG - Intergenic
1201368434 Y:13234729-13234751 GGCAGAGCTGAGCAGACATCAGG - Intergenic