ID: 1135113377

View in Genome Browser
Species Human (GRCh38)
Location 16:19707721-19707743
Sequence GAGTGCTCTGTGTAGGGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135113377_1135113380 -4 Left 1135113377 16:19707721-19707743 CCACGACCCTACACAGAGCACTC 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1135113380 16:19707740-19707762 ACTCCCCCCACCTCCCTACACGG No data
1135113377_1135113386 5 Left 1135113377 16:19707721-19707743 CCACGACCCTACACAGAGCACTC 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1135113386 16:19707749-19707771 ACCTCCCTACACGGCGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135113377 Original CRISPR GAGTGCTCTGTGTAGGGTCG TGG (reversed) Intronic
900985155 1:6068930-6068952 GCGTGCTCAGTGTAGGATGGCGG + Intronic
902434926 1:16392326-16392348 GACTGCTCTGGGTAGGGTCCTGG + Intronic
907724967 1:57011243-57011265 GAGAGCTCTGTCTAGGGGCTGGG + Exonic
909929936 1:81485937-81485959 GAGTGCTATATGTAGGGCAGAGG - Intronic
912775934 1:112506583-112506605 GACTGCCCTGTGTAGGGATGGGG + Intronic
919934106 1:202240423-202240445 GAGTGCTCTGGGGAGGGTGCAGG + Intronic
920996027 1:210992423-210992445 GAGTGCTCTGTTTAGCGCCTTGG - Intronic
921037840 1:211399440-211399462 GAGTAATCTGTGTAAGGTCTGGG + Intergenic
921690170 1:218139614-218139636 GACTGCTTTGTGTAGGGGCTGGG + Intergenic
924418455 1:243883937-243883959 GGGTGCAGTGTGTAGGGTGGGGG - Intergenic
1064746915 10:18487542-18487564 GAGTGATTTGTGGAGGGGCGCGG + Intronic
1076741197 10:132486584-132486606 GAGAGCTCTGTGTGGACTCGGGG - Intergenic
1077062933 11:625663-625685 GAGGCCACTGGGTAGGGTCGGGG + Intronic
1077101082 11:822688-822710 GAGTGCCCAGGGTAGGGTGGTGG + Intronic
1077851406 11:6077266-6077288 GAGTAGTCTGTGTATGGTCTGGG + Intergenic
1078839964 11:15069306-15069328 GAGTAGTCTGTGTATGGTCCAGG - Intronic
1079242857 11:18732998-18733020 GAGTGCTGTGTTTAAGGTCACGG + Intronic
1082295706 11:50439298-50439320 GAGTAGTCTGTGTATGGTCCAGG + Intergenic
1082300068 11:50494410-50494432 GAGTTGTCTGTGTATGGTCTGGG - Intergenic
1084214711 11:67641031-67641053 GAGTGCTCTGTGTGAGTTGGAGG + Intergenic
1089353928 11:117837547-117837569 GGGCGCTCTGTGAAGGGGCGGGG + Exonic
1089681167 11:120119761-120119783 CAGTGCTATGTCTAGGGTGGGGG + Intronic
1090186468 11:124742138-124742160 GAGTGATGTGTGGAGGGTTGGGG + Intronic
1095450556 12:42326303-42326325 GAGTTTTCTGTGTCGGGTCCTGG + Intronic
1104393162 12:128408422-128408444 AAGGGCTCTGTGAAGGGGCGGGG - Intronic
1105795605 13:23849115-23849137 GAGTGCTCTGTGGAGGCAGGCGG - Intronic
1106691121 13:32117847-32117869 GAGTGCTCAGTGTACTGTAGTGG + Intronic
1122026891 14:98884662-98884684 GAGTGATCTCAGTAGGGTAGAGG + Intergenic
1122788540 14:104174904-104174926 CTGTGCTCTGGGGAGGGTCGGGG + Intronic
1123136745 14:106034378-106034400 GAGTGCTCAGTGGAGGGATGGGG - Intergenic
1123147458 14:106146803-106146825 GAGCGCTCAGTGCAGGGTTGGGG - Intergenic
1124865902 15:33490941-33490963 GAGTTCTCTTTGAAGGGTGGTGG + Intronic
1128152141 15:65369788-65369810 GGGTGCCCTGTGTAGGGAGGTGG - Intronic
1129255758 15:74333134-74333156 GAGAGGCCTGTGTAGGGTCCAGG - Intronic
1129884731 15:79030255-79030277 CAGTGCCCTGGGTAGGGCCGGGG + Intronic
1132147317 15:99436553-99436575 GGGTCCTCTGTGGAGGGTCGGGG - Intergenic
1133162154 16:3919241-3919263 GAGTAGTCTGTGTAAGGTCTGGG + Intergenic
1135113364 16:19707670-19707692 GAGTGTGCTGTGTAGGGAGGTGG - Intronic
1135113377 16:19707721-19707743 GAGTGCTCTGTGTAGGGTCGTGG - Intronic
1135113393 16:19707783-19707805 GAGTGTGCTGTGTAGCGTGGTGG - Intronic
1135113410 16:19707864-19707886 GAGTGCGATGTGTAGGGTGGTGG - Intronic
1135113418 16:19707890-19707912 GAGTGTGCTGTGTAGGGAGGTGG - Intronic
1136115540 16:28092023-28092045 GTGGCCTCTGTGGAGGGTCGTGG - Intergenic
1136453145 16:30365586-30365608 GAGCTCTCTCTGCAGGGTCGGGG + Exonic
1136691284 16:32032639-32032661 GAGTGCTCAGTGCAGGGTTGGGG + Intergenic
1136791872 16:32976204-32976226 GAGTGCTCAGTGCAGGGTTGGGG + Intergenic
1136877945 16:33877704-33877726 GAGTGCTCAGTGCAGGGTTGGGG - Intergenic
1137668708 16:50266789-50266811 GAGTGCACTGGGCAGGGTCTGGG + Intronic
1138678231 16:58666995-58667017 GGGTGCTCTGTGGAGGATGGTGG + Exonic
1203094084 16_KI270728v1_random:1237668-1237690 GAGTGCTCAGTGCAGGGTTGGGG + Intergenic
1142613892 17:1124145-1124167 GAGAGCTCTGTGGGGGGTGGAGG + Intronic
1142904851 17:3034678-3034700 GGGGGCTCTGTGGAGGGTGGGGG - Exonic
1145802185 17:27694811-27694833 GAGTAGTCTGTGTATGGTCCAGG - Intergenic
1145883256 17:28366763-28366785 GAGGTCTCTGTCTAGGGTCTAGG - Intronic
1146695494 17:34906387-34906409 AAGTGCTCTGTGTCGGGGTGAGG - Intergenic
1148394714 17:47298873-47298895 GAGTGCCCTGTGTAGGTTCAGGG + Intronic
1148442598 17:47719502-47719524 GAGTGCTCTGGGCAGGGGCTGGG + Intergenic
1152175381 17:78783312-78783334 GAGTGTTCTGTGTAGGGTGCAGG - Intergenic
1155155031 18:23150696-23150718 GAGGGTTCGGTGAAGGGTCGTGG + Intronic
1157764763 18:50287633-50287655 GAGTGGTCTGTGCAGGTTCGCGG - Exonic
1160739793 19:680500-680522 GCGTGGTCTGTGGAGGGGCGGGG + Intronic
1161086303 19:2337162-2337184 GAGTGATCTGTGACGGCTCGCGG + Intronic
1164365735 19:27579872-27579894 GAGTAGTCTGTGTATGGTCTGGG + Intergenic
1166729929 19:45053180-45053202 GAGTGATCTGTGGGGGGACGTGG + Intronic
1166781786 19:45346918-45346940 GGGGGCTCTGTGGAGGGTTGGGG - Intronic
1167895298 19:52575951-52575973 GAGTCCTCTGAGCAGGGTCCAGG - Exonic
1167900605 19:52618984-52619006 GAGTCCTCTGAGCAGGGTCCAGG + Intronic
1167923927 19:52808055-52808077 GAGTCCTCTGAGCAGGGTCCAGG + Exonic
1167933554 19:52888175-52888197 GAGTCCTCTGAGCAGGGTCCAGG + Exonic
1167936775 19:52915244-52915266 GAGTCCTCTGAGCAGGGTCCAGG + Intergenic
1167989431 19:53345562-53345584 GAGTCCTCTGAGCAGGGTCCAGG - Exonic
1167992906 19:53375826-53375848 GAGTCCTCTGAGCAGGGTCCAGG - Exonic
1167995907 19:53402121-53402143 GAGTCCTCTGAGCAGGGTCCAGG - Exonic
1168001447 19:53449568-53449590 GAGTCCTCTGAGCAGGGTCCAGG - Exonic
1168005873 19:53486688-53486710 GAGTCCTCTGAGCAGGGTCCAGG - Exonic
1168018631 19:53593371-53593393 GAGGCCTCTGTGTAGGGCTGAGG + Intergenic
1168245725 19:55112434-55112456 GTGTGCTGTGTGTGGGGTGGGGG - Intronic
925415272 2:3666016-3666038 GAATGCTCTGTGTAGGTTATCGG + Intronic
927087944 2:19689681-19689703 GAGTGCTGTGTGTACTGTTGAGG - Intergenic
929486781 2:42361601-42361623 GCGTGGTCTGGGTAGGGGCGGGG + Exonic
929549333 2:42879537-42879559 GAGAGGTGTGTGTGGGGTCGAGG + Intergenic
929940302 2:46328563-46328585 GAGAGCTCTGTGAAGGTTTGTGG - Intronic
931208875 2:60173584-60173606 GAGTGATCTGTATAGGGGCAAGG - Intergenic
931712435 2:65000221-65000243 GAGGGCTCTGTGTAGGATGCTGG - Intronic
933285314 2:80378904-80378926 GAGAGTTCTGTGTAGGCTCTGGG + Intronic
934095240 2:88595878-88595900 GAGTACTATGTGTAGGGCCTGGG - Intronic
937550412 2:123081753-123081775 GTGTGCTCTCTGCAGGGTGGTGG + Intergenic
942470541 2:176255214-176255236 GAGGGCTCTGTGGAGGGCAGAGG - Intergenic
945841234 2:214890253-214890275 GAGTGTTCTGTGTAGGTGGGTGG + Intergenic
946178250 2:217935060-217935082 GAGAGGTCTGTGTAGTGCCGCGG - Intronic
947526426 2:230879290-230879312 GGGTGCTCCGGGCAGGGTCGAGG + Intergenic
947705879 2:232275108-232275130 GAGTGAGGTGTGTAGGGTTGCGG - Intronic
948866732 2:240778938-240778960 GAGCGCTGTGTGTAGGAACGGGG - Intronic
1168860688 20:1044161-1044183 GAGTGCTGTGGGAAGGATCGGGG + Intergenic
1170798510 20:19570888-19570910 GAGTGCTCTTTGGAGGATAGAGG + Intronic
1175149424 20:56921488-56921510 GAGTGCTCTTTGTTTGGTCTGGG - Intergenic
1175291594 20:57879547-57879569 GTGTGGGCTGTGCAGGGTCGGGG - Intergenic
1175937941 20:62523533-62523555 GAGGGCTCTGGGGAGGGCCGGGG - Intergenic
1180109021 21:45639186-45639208 GAGTGCTCTGTGTGCAGTGGGGG + Intergenic
1182794875 22:32984603-32984625 GAGTGCAATTTGTAGGGTCTTGG + Intronic
1183832104 22:40423746-40423768 GAGGACCCTGTGTAGGGTCAGGG - Intronic
953336380 3:42097875-42097897 GTGTGCTCTGGGAAGGGTTGTGG + Intronic
956643003 3:71432332-71432354 AAATGCTCTGTGCAGGGCCGGGG - Intronic
957353265 3:79052870-79052892 GAGTAGTCTGTGTATGGTCCGGG + Intronic
959156422 3:102672013-102672035 GTGTGCTCTGTTTGGGGCCGAGG + Intergenic
961333175 3:126154889-126154911 GGGGCCTCTGTGTAGGGTCTGGG - Intronic
961923574 3:130452156-130452178 GAGTAGTCTGTGTATGGTCTGGG - Intronic
962575636 3:136752581-136752603 GAGCGCTCCGTGTGGGGGCGGGG - Intergenic
968453041 4:684044-684066 CAGTGCTCAGTGTAGGATTGGGG - Intronic
969009249 4:4047952-4047974 GAGTAATCTGTGTAAGGTCTGGG - Intergenic
969278752 4:6154910-6154932 GCGTGCTCTGTGTTGGTTTGTGG - Intronic
969603989 4:8193142-8193164 ACGTGCTCTGGGTAGGGCCGGGG - Intronic
979708325 4:123747815-123747837 GAGTGTTCTTTGTAGGGTAGAGG + Intergenic
980895549 4:138856298-138856320 GAGTGCTCTGTGTATGGTGGTGG - Intergenic
989317965 5:40104134-40104156 GAGTGGTCTGTGTATGGTCCGGG + Intergenic
989830713 5:45915120-45915142 GAGTAGTCTGTGTATGGTCTGGG - Intergenic
992611004 5:78508502-78508524 GAGGCCCCTGTGTAGGGTGGAGG - Intronic
997076918 5:130689746-130689768 GAGTGCTCTGAGTATGGGCATGG - Intergenic
1000729762 5:164818950-164818972 GAGTGCTATGGGTGGGGTGGTGG + Intergenic
1009248912 6:61274662-61274684 GAGTAGTCTGTGTATGGTCCAGG + Intergenic
1010492891 6:76495463-76495485 GAGTAGTCTGTGTATGGTCTGGG - Intergenic
1015602960 6:134928340-134928362 GAGTGCACTGTGCAGTGTCACGG + Intronic
1016259223 6:142147516-142147538 GAGTTCCCTGGGTAGGCTCGAGG - Intronic
1022523270 7:31021239-31021261 GAGTGGTCTGTGAGGGGTCATGG + Intergenic
1024552751 7:50577208-50577230 GAGTAGTCTGTGTATGGTCCGGG + Intergenic
1029911293 7:104151763-104151785 TAGTGCTCTGTGTATGTTGGTGG - Intronic
1032002075 7:128271992-128272014 GTGGGCTCTGTGAAGAGTCGGGG - Intergenic
1033920606 7:146387047-146387069 GAGTGCTTTTTATAGGGTAGGGG - Intronic
1036250525 8:7158626-7158648 GAGTAATCTGTGTAAGGTCTGGG - Intergenic
1036366958 8:8128827-8128849 GAGTAATCTGTGTAAGGTCTGGG + Intergenic
1036744807 8:11399122-11399144 GAGTCCTCTATGGAGGGTAGTGG + Intronic
1036883922 8:12536834-12536856 GAGTAATCTGTGTAAGGTCTGGG - Intergenic
1045008457 8:97936538-97936560 GAGTGGTCAGTGTAGGGAGGTGG - Intronic
1046732186 8:117737662-117737684 GAGTTCTCTGTGTTCGGTCTTGG + Intergenic
1048580091 8:135723512-135723534 GAGTTCTGTGTGTGGGGCCGCGG + Intergenic
1049735739 8:144203384-144203406 GAGTACTCTGTAGAGGGTCCTGG + Intronic
1051356749 9:16246468-16246490 GAGTCCTATGTGGAGGGTGGAGG - Intronic
1056281369 9:85044166-85044188 GTTTGCTCTGTGTAAGGTGGAGG - Intergenic
1056913606 9:90725796-90725818 GGGGGCTCTGTGCAGGGTCGTGG - Intergenic
1057198935 9:93130199-93130221 GTCAGCTCTGTGTAGGGGCGTGG + Intronic
1057221538 9:93260239-93260261 GAGTGGACTGTGTAGGGGTGTGG - Intronic
1057486844 9:95492085-95492107 GAGTGGGTTGTGTAGGGGCGAGG - Intronic
1059009965 9:110446476-110446498 GAGTGGTCTGTGCAGGTTTGGGG - Intronic
1059332085 9:113542101-113542123 GAGTGCTGTGTGTGGGGGTGGGG + Intronic
1060014349 9:120073583-120073605 GAGTGCCCTGTGTATGTTTGTGG - Intergenic
1060167878 9:121434577-121434599 GAGTTCTCTGTATTGGGTCAGGG + Intergenic
1060173495 9:121480427-121480449 GTGTGCTCTGTTTCAGGTCGTGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061849479 9:133405989-133406011 GACTGCTCTGTCCAGGGGCGAGG - Exonic
1188822916 X:34797208-34797230 GAGTAGTCTGTGTATGGTCGGGG + Intergenic
1189978890 X:46489533-46489555 GAGTAGTCTGTGTATGGTCCCGG - Intronic
1190526303 X:51332640-51332662 GTGGGCTCTGTGGAGAGTCGCGG + Intronic