ID: 1135113955

View in Genome Browser
Species Human (GRCh38)
Location 16:19710478-19710500
Sequence GGGGCTAGGGCTCTGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135113955_1135113962 -1 Left 1135113955 16:19710478-19710500 CCTCCTCGCAGAGCCCTAGCCCC 0: 1
1: 0
2: 2
3: 25
4: 260
Right 1135113962 16:19710500-19710522 CAAACTTACCGTCCACTTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135113955 Original CRISPR GGGGCTAGGGCTCTGCGAGG AGG (reversed) Intronic
903172120 1:21560836-21560858 GGGGCTAGGGCTCTGGAGGAAGG + Intronic
903282754 1:22259331-22259353 GGGGCTAGGAATCCGCGTGGGGG + Intergenic
903573862 1:24325736-24325758 GGGGCCAGTGCTCTGGGAGGAGG - Intronic
904260046 1:29283136-29283158 GGGGCCAGGGCTATGGGAGGTGG - Intronic
904379595 1:30101938-30101960 GGGGCTCAGGCCCTGTGAGGGGG - Intergenic
905003800 1:34694468-34694490 GGGGCTTGGTCTTTGCAAGGTGG - Intergenic
905247760 1:36626778-36626800 GTGGGAAGGGCTCTGGGAGGAGG + Intergenic
905466059 1:38154290-38154312 GGTGCCAAGGCTCTGCGATGGGG - Intergenic
907118584 1:51990205-51990227 GGGGCGGGGGAGCTGCGAGGAGG - Intronic
914937597 1:151994001-151994023 CGGGCGAGGCCTCTGCGAGGCGG - Exonic
915544931 1:156591782-156591804 GGGGCGCGCGCTCTGCGAGCTGG + Exonic
915783603 1:158582139-158582161 GGGACTAGGGGGCAGCGAGGGGG + Intergenic
917853352 1:179083076-179083098 GGGGCTAGGGATCTGTGGGGAGG + Intronic
919911393 1:202113108-202113130 GGGTCAAGGGCTCAGGGAGGGGG + Intergenic
921010283 1:211134135-211134157 GGCGCGAGTGCACTGCGAGGCGG - Intergenic
922297244 1:224261662-224261684 AGGGCTAGGGCTATGCACGGTGG + Intronic
1062961660 10:1577090-1577112 AGGCCTAGGGCTCTACAAGGTGG - Intronic
1062992965 10:1837063-1837085 GGGGCTGGGGCTGTGCGGTGGGG - Intergenic
1063398296 10:5714909-5714931 GGGGCTAGGGTTGTGGGAGTGGG + Intronic
1064137878 10:12766262-12766284 GGGGCCAGGGCTGGGGGAGGAGG - Intronic
1064645151 10:17453508-17453530 GGGGCTCGGGAGCTGCGAGCCGG - Intronic
1065971132 10:30806754-30806776 GGGCCTTGGGCCCTGCCAGGAGG + Intergenic
1066371208 10:34819707-34819729 GGGACTTGGGCTCTGAGTGGTGG - Intergenic
1069806320 10:71127214-71127236 GGGCTGAGGGCTCTGCGATGGGG + Intergenic
1072668338 10:97410775-97410797 GGGGATAGGGCTGGGCGCGGTGG + Intronic
1075100461 10:119502812-119502834 TGGGCAAGGGCTCTCAGAGGAGG - Intronic
1075657759 10:124173377-124173399 GCTGCAAGGGCTCTGGGAGGAGG + Intergenic
1076035391 10:127195691-127195713 GGGGCTGCGCCTCTGCGATGTGG - Intronic
1076450662 10:130554846-130554868 GGGGCTAGGGCCTTGAGAGTTGG + Intergenic
1076796635 10:132801556-132801578 GTGGCTGGGGCTCTCCGAGGTGG + Intergenic
1076796903 10:132802864-132802886 AGGGCTGGGGCTCAGCGATGCGG + Intergenic
1076850257 10:133088946-133088968 GGGGCTAGGCCGCTGCGGGGGGG + Intronic
1076898753 10:133326850-133326872 GGGGCCAGGGCTCTGGTGGGGGG - Intronic
1076990694 11:271969-271991 GGGGCCAGGGCTGTGGGAAGGGG - Intergenic
1077026994 11:444613-444635 GGGGAGAGAGCTCAGCGAGGCGG + Intergenic
1077323324 11:1952265-1952287 GAGGCTGTGGCTCGGCGAGGTGG - Intronic
1077457345 11:2688947-2688969 GGGCCTAGGGCTCTGAGAGTAGG + Intronic
1077487338 11:2845193-2845215 GGGGCGGGGCCTCTGGGAGGGGG - Intronic
1078730732 11:13971686-13971708 GGGGCTGGGGCTAGGAGAGGTGG - Intronic
1079101440 11:17544444-17544466 GGGGCCAGGCCTCTGTGGGGCGG + Intergenic
1079352427 11:19703262-19703284 GGGTTTAGGACTCTGAGAGGAGG - Intronic
1082159936 11:48880064-48880086 GGGGCTTAGGCTCTGTCAGGAGG - Intergenic
1082908778 11:58345451-58345473 GGAGCTTGGGCTCTGGGAAGAGG + Intergenic
1083665505 11:64271929-64271951 GGGACTGGGGCTCTGAGAGGTGG - Intronic
1084973117 11:72781925-72781947 GGCGCTAGGACCCTGCGGGGTGG - Intronic
1088481013 11:110296499-110296521 GTGGCTGGGGCGCTGCGCGGCGG + Exonic
1089753350 11:120667591-120667613 GGGGCTGGGGCTCGGCTCGGTGG + Intronic
1090332669 11:125943841-125943863 GGGGCTGTGGCTCTGCCATGGGG + Intergenic
1090406754 11:126480636-126480658 GGCCCTAGAGCTCTGCGAAGCGG + Intronic
1091085013 11:132713046-132713068 GGGGATAGGGATCTATGAGGGGG - Intronic
1202806312 11_KI270721v1_random:7460-7482 GAGGCTGTGGCTCGGCGAGGTGG - Intergenic
1092234351 12:6796935-6796957 GGTGGTAGGGATGTGCGAGGAGG - Intronic
1096260261 12:50085649-50085671 GGGGTTCGGGCTCTGGGTGGGGG + Intronic
1096806760 12:54145655-54145677 GGGGCAAGGGCACTGAGGGGAGG + Intergenic
1097234108 12:57528225-57528247 GGGGCTAAGGCACTGAGGGGAGG - Exonic
1097687013 12:62700589-62700611 GGTGCTAGGGCTCTGACAGCAGG - Intronic
1102440500 12:112960341-112960363 GCTGCTAGGGCTCTGGGTGGGGG - Intronic
1102779688 12:115553389-115553411 GGGGTGAGGGCTTTGGGAGGTGG - Intergenic
1104015335 12:124958072-124958094 GGGGCCAGGGAGCTGGGAGGTGG + Intronic
1104272403 12:127293952-127293974 GAGCCCAGGCCTCTGCGAGGAGG + Intergenic
1104764159 12:131315726-131315748 GGGGCTTAGGCCCTGCGAGTGGG - Intergenic
1104891057 12:132140385-132140407 GGGGCAAGGCCTCTGTGGGGTGG - Intronic
1106564109 13:30870650-30870672 GGAGTCAGGGCTCTGTGAGGTGG + Intergenic
1106564153 13:30870881-30870903 GGAGTCAGGGCTCTGTGAGGTGG + Intergenic
1111992210 13:95127670-95127692 GGGGATAGAGTTCTGAGAGGTGG - Intronic
1112359514 13:98704909-98704931 GGGGCTAGGGCTGGGCGCGGTGG + Intronic
1113778602 13:112963030-112963052 GGGCCTGGAGCTCTGGGAGGTGG + Intronic
1113853421 13:113430887-113430909 GGGGCAAGGGCTCGGCAACGGGG - Intronic
1114063186 14:19038254-19038276 GAGTCCAGGGCTCTGCGGGGCGG + Intergenic
1114099071 14:19361741-19361763 GAGTCCAGGGCTCTGCGGGGCGG - Intergenic
1114483284 14:23048186-23048208 GGCGCTGCGGCTCCGCGAGGCGG - Exonic
1114567286 14:23641955-23641977 GGAGCTAGGGCAGTGCCAGGTGG - Intronic
1117599144 14:57355658-57355680 GGGGCTAGGAGGCTGGGAGGAGG + Intergenic
1117911455 14:60641903-60641925 GGGGCCAGGGCTGTGCGTGGGGG + Intergenic
1118392042 14:65303915-65303937 GGGGCTGGGGGGCTGGGAGGGGG - Intergenic
1119357478 14:74019188-74019210 GGGGCCCGGGCTCTGCGGGCGGG - Intronic
1119466181 14:74860686-74860708 GGGGCCAGGGTGCTGCTAGGGGG + Intronic
1119643182 14:76329857-76329879 GCGGCTAGGGATGTGCGGGGGGG + Intronic
1122194067 14:100071759-100071781 GGGGCTCTGGGTCTGGGAGGAGG + Intronic
1122349383 14:101078621-101078643 GGGGCTGGGGCTTTGGAAGGAGG - Intergenic
1122862225 14:104587802-104587824 GGGGCTTGGCCTCTGGGCGGTGG - Exonic
1122905602 14:104800340-104800362 GGGTTTAGGGCACTGCGCGGGGG - Intergenic
1122920091 14:104876478-104876500 GGGGCTATGGCTGGGGGAGGAGG - Intronic
1122981942 14:105196022-105196044 GGGGCTGGGTCTCTGGGAGCTGG - Intergenic
1123062196 14:105599407-105599429 GGGGCCAGGACTCGGCAAGGCGG + Intergenic
1123086941 14:105721135-105721157 GGGGCCAGGACTCGGCAAGGTGG + Intergenic
1123755568 15:23395250-23395272 GGCTCTGAGGCTCTGCGAGGTGG - Intergenic
1124619859 15:31267442-31267464 GGGGCTGGGGCTTTGCTGGGAGG - Intergenic
1125070341 15:35546431-35546453 TGGGCTTGGGCTCTGCAACGCGG - Intergenic
1127972148 15:63970076-63970098 GAGGCTGGGGCTCAGCTAGGAGG - Intronic
1128800325 15:70492966-70492988 AGGGCTTGGGCTGTGCGATGTGG - Intergenic
1129740818 15:77988767-77988789 GGAGCCAGGCCTCTGCGAGGAGG + Intronic
1129844907 15:78763773-78763795 GGAGCCAGGCCTCTGCGAGGAGG - Exonic
1130043644 15:80427234-80427256 GGGGCTGGGGCTGTGTGAGTGGG + Intronic
1130994824 15:88897857-88897879 GGGGCCGGGGCTCTGCCAAGTGG - Intergenic
1132655788 16:1041198-1041220 TGAGCTAGGGGTCTGGGAGGAGG - Intergenic
1132655826 16:1041327-1041349 GGAGCTGGGGGTCTGGGAGGAGG - Intergenic
1132655835 16:1041349-1041371 GGAGCTGGGGGTCTGGGAGGTGG - Intergenic
1132687061 16:1166748-1166770 AGGGTCAGGGCTCTGCGGGGAGG - Intronic
1132698860 16:1213769-1213791 GGCGCTGGGCCTCTGCGGGGAGG - Exonic
1133027823 16:2996392-2996414 GGGCCCAGGGCCCTGGGAGGGGG - Intergenic
1133350635 16:5098286-5098308 GGTGCTCGGACTCTGGGAGGCGG + Intergenic
1133691764 16:8222442-8222464 GGGGCCAGGCCTCAGCTAGGAGG - Intergenic
1134460808 16:14427775-14427797 GGCTCTGAGGCTCTGCGAGGTGG + Intergenic
1135113955 16:19710478-19710500 GGGGCTAGGGCTCTGCGAGGAGG - Intronic
1137595365 16:49720083-49720105 GGGGGCAGTGCTCTGGGAGGTGG - Intronic
1137673484 16:50292423-50292445 GGGCCCTGGGCTCTGTGAGGTGG + Intronic
1138596452 16:58031685-58031707 GGGGCTGGGACTCTGGGTGGTGG - Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1140106351 16:71964072-71964094 GGGCCTATGGCTCTGTGAAGTGG - Intronic
1140490784 16:75334188-75334210 AGGGTTAGGGTGCTGCGAGGAGG - Intronic
1142140007 16:88468682-88468704 GGGGGTGGGGCTCTGGGGGGCGG - Intronic
1142694735 17:1627658-1627680 GGAGCTGGGGCTTTGGGAGGGGG - Intronic
1143005365 17:3829001-3829023 GTGGCCAGGGCTCTAGGAGGTGG - Intronic
1143503498 17:7351865-7351887 GGGCCTCGGGCTCTGAGCGGTGG + Intergenic
1144065037 17:11617341-11617363 GGGACTAGGGCTCCACCAGGTGG + Intronic
1144550946 17:16240463-16240485 GGGGCTGGGGCTGCGCGTGGTGG - Intronic
1144768461 17:17745883-17745905 CAGGCTTGGGCCCTGCGAGGTGG + Intronic
1145267926 17:21389426-21389448 GGGGCCAGGGCTCCGGGATGTGG - Intronic
1147152847 17:38528289-38528311 GGGGCTGGGGCTCTGTCTGGCGG - Intergenic
1147926685 17:43950957-43950979 AGGGAAAGGGCTCTGCAAGGAGG + Intergenic
1148028111 17:44602157-44602179 GGAGCTAGGGCTCTGCAGGAAGG + Intergenic
1148485346 17:47987377-47987399 TGGGCTCAGGCTCTGCCAGGCGG - Intergenic
1149597373 17:57872321-57872343 GGGGCTGGGGCTCTGTGAGGAGG + Intronic
1149651710 17:58280060-58280082 TGGGCTGGGGCTCTGCTGGGTGG - Intronic
1149916432 17:60613910-60613932 GAGGCTTGGGCTGTGTGAGGCGG - Intronic
1149984357 17:61335983-61336005 GGAGCGAGGGCTCCCCGAGGTGG - Intronic
1151354453 17:73550210-73550232 GGGGCCAGGGGTCAGGGAGGTGG + Intronic
1151434844 17:74088775-74088797 GGAGCTGGGGCTCTGGGAGCAGG - Intergenic
1151656723 17:75499657-75499679 GGGGCAAGGGATCTCCAAGGGGG - Exonic
1151763595 17:76121399-76121421 GGGGCTAAGGCTGGGCTAGGGGG - Intronic
1152066868 17:78117023-78117045 GGGACCAGGGCTCTGGGGGGTGG - Intronic
1152070587 17:78131990-78132012 GGGCCTTGGGCTCTGGGAGGGGG + Exonic
1152121242 17:78419985-78420007 GGGGCAAGGGCTCAGGGATGAGG + Intronic
1152321157 17:79609609-79609631 GGGGCGGGGGCCCAGCGAGGTGG - Intergenic
1152690985 17:81717559-81717581 GGGGCGAGGGCTGGGGGAGGCGG + Intronic
1152734647 17:81991451-81991473 GAGGACAGGGCTCTGCCAGGTGG + Intronic
1153480675 18:5543620-5543642 GGGGCTCAGGCTCTGCGCGCCGG + Intronic
1157327594 18:46680227-46680249 GGCGCTGGAGCTCTGTGAGGAGG - Exonic
1158440480 18:57470585-57470607 GGTTCTATGGCTCTGTGAGGAGG + Intronic
1159798086 18:72867721-72867743 GGGGAGAGGGCGCAGCGAGGTGG + Exonic
1160222223 18:76985672-76985694 GGTGCTAGGGGACTGGGAGGTGG - Intronic
1160837583 19:1132033-1132055 GGGGGCAGGGGTCTGGGAGGTGG - Intronic
1160858296 19:1227174-1227196 GGGGCTGGGGCTGGGAGAGGAGG - Intronic
1160942641 19:1627581-1627603 GGGGCCAGGGCTCCCCGAGATGG - Intronic
1161168568 19:2801812-2801834 GGGCCTGGGGCTTTGTGAGGAGG - Intronic
1161251017 19:3280288-3280310 GGGGCTGGGGCTGGGCGTGGTGG + Intronic
1161260845 19:3337038-3337060 CGGGCTAGGCCTCTTCCAGGAGG + Intergenic
1161495483 19:4583913-4583935 GGGGGTAGGGGTGTGCGGGGAGG + Intergenic
1161678510 19:5667107-5667129 GGGGCTATGGCTCTGACAAGAGG + Exonic
1161746624 19:6064076-6064098 GGGGTGAGGGATCTGTGAGGGGG - Intronic
1162030194 19:7914013-7914035 GGGGCCAGGGGTCTGCCGGGTGG + Exonic
1162296860 19:9819398-9819420 GGGGCTGGGGCGCGGCTAGGGGG + Intronic
1162374238 19:10295636-10295658 GGGGCGAGGTATCTGAGAGGGGG + Intronic
1163015221 19:14450661-14450683 GGGGCGGGGCCTCAGCGAGGGGG + Intronic
1163151708 19:15418873-15418895 TGGGGTCGGGCTCTGCGTGGGGG - Intronic
1163373307 19:16914597-16914619 AGGGCTGGGGCTCTGGGAGGAGG + Intronic
1163846336 19:19640258-19640280 GGGGCTTGGGCTCTCCGGGGGGG + Intronic
1166050314 19:40255343-40255365 GGGGCTAGGCCTGTGGGAGGTGG - Intronic
1166289088 19:41850390-41850412 GGATCTAGGGCCCTGGGAGGAGG + Intronic
1167633474 19:50639747-50639769 GGGGCTGGGGCTGTGGCAGGAGG + Intronic
1167665650 19:50821682-50821704 GGGGCCTGGGGTCTGGGAGGAGG - Intronic
927554334 2:24021772-24021794 GGGGGCAGGGCTCTGCTTGGGGG + Intronic
928089956 2:28367928-28367950 AGGGCCAGGGCTGTGAGAGGCGG + Intergenic
929701681 2:44168440-44168462 GGGGCCGGGGCTTTGCTAGGAGG + Intronic
929878502 2:45816713-45816735 GGGGCTAGGGCCATGCAGGGTGG - Intronic
932287418 2:70548378-70548400 GGGGCCAGGGCTCTGCTACCGGG + Intronic
932314133 2:70768326-70768348 GGGGCGAGGCCGCTGCGGGGCGG - Intergenic
938422401 2:131155434-131155456 GGGGCTGGGCCTCTCCCAGGGGG + Intronic
943033854 2:182716399-182716421 GGTGCTTGGGCTCGGCCAGGCGG + Exonic
944743689 2:202635447-202635469 GGGGCTGGTGCTGCGCGAGGCGG - Exonic
948742968 2:240060292-240060314 GGGGCTGGAGCTGTGCAAGGAGG - Intergenic
948778372 2:240301764-240301786 GGGGCTAGGGCCAGGCCAGGGGG + Intergenic
948831232 2:240599212-240599234 GGGGCTGGGGGCCTGGGAGGTGG + Intronic
949027917 2:241774918-241774940 GGGGTTAGGGCTCTGCCATGGGG + Intergenic
1172519460 20:35557578-35557600 GGGGCTGGGGCTGACCGAGGAGG - Exonic
1172614683 20:36275343-36275365 GAGGCTGGGGCTCTGGAAGGAGG + Intergenic
1174353220 20:49982682-49982704 GAAGCGAGGCCTCTGCGAGGTGG - Intergenic
1174413790 20:50353586-50353608 GGGGCAGGGGATCTGCGTGGGGG + Intergenic
1175204410 20:57300893-57300915 GAGGCTAAGGCTCTGTTAGGAGG + Intergenic
1175410138 20:58762350-58762372 GGTGGAAGGGCTCTGTGAGGAGG + Intergenic
1175762478 20:61571052-61571074 GGGGCAAGGCCTGTGCAAGGTGG + Intronic
1176021250 20:62963465-62963487 GGGCCTAGGGCTCAGAGAAGTGG + Intronic
1176096287 20:63345932-63345954 AGGGCCAGGGCTCTGGCAGGTGG - Exonic
1179731390 21:43369715-43369737 GGGGCTCGTGCTCTGAGAGATGG - Intergenic
1180844389 22:18973340-18973362 GGGGCTGGGGCCCTGGAAGGTGG + Intergenic
1181057083 22:20265371-20265393 GGGGCTGGGGCCCTGGAAGGTGG - Intronic
1183354370 22:37350548-37350570 GGGCCTAGGGCCCTGCGGTGGGG - Intergenic
1183437992 22:37806381-37806403 GGGGTTAGGGATTTGCGGGGGGG + Exonic
1183439847 22:37816962-37816984 GGAGCCAGGGCTCTGAGGGGAGG + Exonic
1183536051 22:38402008-38402030 GGGGCTCGGGCTCTCCGGGCGGG + Intergenic
1183898822 22:40990295-40990317 GGGGGTGGGCCTCTGGGAGGAGG + Intergenic
1183910208 22:41073505-41073527 GGAGGTAGGGCTCTGGGAGGTGG + Intergenic
1183970529 22:41474111-41474133 GGGACTAGGGATCTGGGGGGTGG + Intronic
1184293656 22:43510855-43510877 GGGGCTGGGGCTCTGGGAGTGGG - Intergenic
1184340640 22:43884105-43884127 GTGGGTAGGGCTCGGCGGGGTGG - Intronic
1184611675 22:45607828-45607850 GGGGAGGGGGCTCTGGGAGGGGG + Intergenic
1185185969 22:49400443-49400465 GGGGCGGAGGCTCTGCGAGGCGG - Intergenic
1185385789 22:50530841-50530863 GGGGCCCGGGGTCTGCGAGAGGG + Exonic
949910996 3:8907851-8907873 GGGGCTAGGACACTGCTACGGGG + Intronic
950031742 3:9858350-9858372 GGGGCAAGGGTCCTGCGAGCTGG + Intergenic
950215192 3:11154215-11154237 CGGGCTCGGGCTCTGCGAGGCGG - Intronic
950631530 3:14285186-14285208 GTGGCCAGGGCTTTGCCAGGGGG + Intergenic
950792909 3:15487643-15487665 GGGGCCAGGACTCTGTGGGGTGG + Intronic
953875793 3:46666200-46666222 GGGGCCAGGCCTCAGCCAGGGGG + Intergenic
956745388 3:72307087-72307109 GGGGCTAGAGCTTTGCAAAGCGG - Intergenic
958267711 3:91459050-91459072 GGGTCTAGAGCTCAGGGAGGTGG + Intergenic
960937586 3:122913069-122913091 GGGGCTAGGCCTCAGCGACTGGG + Intronic
961028829 3:123584848-123584870 GAGGCTGGGGCTCGGGGAGGCGG - Intronic
961305686 3:125958247-125958269 GGGGCTCGGGCCCTGGGCGGAGG - Intergenic
961783790 3:129337365-129337387 GGGGCAAGGGTCCTGCGAGCTGG + Intergenic
961810989 3:129521567-129521589 GGGGCAAGGGCTCTGGGATGGGG - Intergenic
961906208 3:130265203-130265225 GGGGCAAGGGCTGTGCCAGTGGG + Intergenic
968545510 4:1195715-1195737 GGGGCTGGGGGTCTCCGGGGTGG - Intronic
968592644 4:1466543-1466565 GGGGCCTGGGGTCTGTGAGGAGG - Intergenic
968596887 4:1490323-1490345 GGGGCCGGGGCTCCGGGAGGCGG - Intergenic
968698154 4:2042542-2042564 GGGGCCGGGGCTCTGCGGGGAGG + Intronic
968997718 4:3955939-3955961 GGTGCTCGGACTCTGGGAGGCGG + Intergenic
969697323 4:8742090-8742112 CGGGGTAGGGCACTGGGAGGGGG - Intergenic
973954524 4:56049426-56049448 GGGGCGTGGGCTCGGCGCGGCGG + Intergenic
975529539 4:75386185-75386207 TGGGCTAGGGCTCTGGGAGTGGG - Intergenic
978498725 4:109386375-109386397 GGGGCTGGGGGTCTGGGAAGGGG + Intergenic
981074632 4:140578832-140578854 GGACCTAGGGCTCAGGGAGGAGG - Intergenic
983792356 4:171813496-171813518 CGGACGAGGGCGCTGCGAGGAGG - Exonic
984990098 4:185371867-185371889 TGAGCTAGGGCTCGGAGAGGGGG + Intronic
985328234 4:188796818-188796840 GGGGCGCGGGGTCTGTGAGGTGG - Intergenic
989491451 5:42060284-42060306 GGAGGTAGAGCTCTGCGAGATGG - Intergenic
990753190 5:59039730-59039752 GGGGGGATGGCACTGCGAGGTGG - Intronic
995759159 5:115544975-115544997 GGGGGCGGGGCGCTGCGAGGGGG + Intergenic
997587152 5:135050242-135050264 GGGGCTAGGGCGATGGAAGGGGG + Intronic
999106439 5:149075244-149075266 GTGGCTTGGGCTCTAGGAGGTGG - Intergenic
1002451071 5:179318798-179318820 GGGGCCTGGCCTCTGAGAGGCGG + Intronic
1008987503 6:57562535-57562557 GGGTCTAGAGCTCAGGGAGGTGG - Intronic
1009175460 6:60455092-60455114 GGGTCTAGAGCTCAGGGAGGTGG - Intergenic
1016792452 6:148079700-148079722 TGGGCTAGGACTCTGCTAGAAGG + Intergenic
1017074112 6:150601451-150601473 GGGGGTAGGGGTTTGGGAGGGGG - Intronic
1018788988 6:167131611-167131633 GGGGCTTGGGGACAGCGAGGGGG - Intronic
1019599274 7:1873366-1873388 AGGGGCAGGGCTCTGGGAGGAGG + Intronic
1023805451 7:43869599-43869621 GGGGCAGGGCCTCTGCGGGGCGG + Intronic
1023875785 7:44285520-44285542 AGGCCAAGGGCTCTGCGTGGTGG + Intronic
1024023627 7:45392247-45392269 GGTGCTAGCGCGCTGCGTGGTGG + Intergenic
1026923830 7:74174867-74174889 GGGGCCAGGGGCCTGCAAGGCGG - Intronic
1027165122 7:75828834-75828856 GGGGCTGGGTCTCTGCAAGCAGG - Intergenic
1027166017 7:75834901-75834923 GGGGCTGGGTCTCTGCAAGCAGG + Intergenic
1028424431 7:90670759-90670781 GGGGCTGGGCCTGTGGGAGGAGG - Intronic
1029739492 7:102483468-102483490 GGGCCTAGGTCTCTTCCAGGTGG - Exonic
1029757493 7:102582647-102582669 GGGCCTAGGTCTCTTCCAGGTGG - Exonic
1029775431 7:102681708-102681730 GGGCCTAGGTCTCTTCCAGGTGG - Intergenic
1034460149 7:151193576-151193598 GGGCCTAGGGCTGGGGGAGGAGG + Intronic
1034465657 7:151227053-151227075 GGATGGAGGGCTCTGCGAGGGGG - Intronic
1035328761 7:158083042-158083064 GGGAGTAGGGCTTTGAGAGGGGG - Intronic
1037572858 8:20173176-20173198 GGACCAAGGGCTCTGAGAGGCGG - Intronic
1039008256 8:33064927-33064949 GGGGATAGGGGTCTGAGAAGGGG + Intergenic
1039578483 8:38644738-38644760 GGGGCTGGGGCTCAGTGGGGAGG - Intergenic
1040046976 8:42974636-42974658 GGAGCCCGGGCTTTGCGAGGAGG - Intronic
1041389878 8:57338783-57338805 GGGACTAAGGCTCTGTGAGGTGG - Intergenic
1041891156 8:62870055-62870077 GGGGCTGGGGCTGGGCGCGGTGG - Intronic
1043558560 8:81463229-81463251 GGGGCCAGGGCTATGGGGGGAGG + Intergenic
1044800142 8:95945423-95945445 GGGACTGGGGCACTGCGAGAAGG + Intergenic
1047162561 8:122397120-122397142 GGAGCTGTGGCTCTACGAGGAGG - Intergenic
1048224866 8:132575551-132575573 GTGGCAAGGGCTCTGCAAGTAGG + Intronic
1049775110 8:144400527-144400549 GGGCCTGGGTCTCTGCGGGGAGG - Intronic
1050568363 9:6911821-6911843 GGTGCTGGGGCTCGGGGAGGTGG + Intronic
1052971107 9:34377598-34377620 GGGGGTAGCGGTCTGGGAGGCGG - Intergenic
1053142148 9:35689095-35689117 GGAGTTAGGGCTCTGGGAAGGGG - Intronic
1054451670 9:65406660-65406682 GGGGCTGGTGCTCTGCCAGCTGG + Intergenic
1056063624 9:82910513-82910535 GGGGCCAGGGCTGTGCAAAGAGG - Intergenic
1056475493 9:86947632-86947654 GGGGCCGGGGCTCGGCGAGCCGG - Intergenic
1056579879 9:87883052-87883074 GGAGCTAGGGCTCAGCCATGTGG - Exonic
1058727943 9:107821415-107821437 GGGGCTGGGCCTCTTGGAGGAGG + Intergenic
1059428237 9:114234518-114234540 GAGGCCAGGGCTGTGTGAGGTGG + Intronic
1060093326 9:120764390-120764412 GGGGCCAGGGCTCGGGGTGGGGG - Exonic
1060891633 9:127192911-127192933 GTGCCAAGGGCTCTGGGAGGAGG + Intronic
1060972569 9:127747163-127747185 GGAGCTAGGGCTCTCGGAGATGG + Exonic
1061188468 9:129068744-129068766 GGGCCCAGGCTTCTGCGAGGTGG + Intronic
1061368922 9:130187099-130187121 AGGGCAAGGGCTCCGCTAGGAGG + Intronic
1061700323 9:132410533-132410555 GGGGCCAGGGCGCTGCGGGTGGG - Intronic
1061929727 9:133826322-133826344 GGGGCCAGGGCTCTGGGCGAGGG - Intronic
1062187343 9:135224978-135225000 GGGGGTGGGGTTCTGCCAGGAGG - Intergenic
1062353436 9:136150148-136150170 GGGGCTGGGGCCCTGGGAGGAGG + Intergenic
1062521480 9:136959733-136959755 GGGGCATGAGCTCTGCGAAGGGG - Intergenic
1062709610 9:137967450-137967472 GAGGTTAGGGCTCTGAGAGCGGG - Intronic
1190213512 X:48466210-48466232 GGGGTGAGGACTCTGGGAGGTGG - Exonic
1196866599 X:120076728-120076750 GGTGCCAGGGGTCTGCGGGGAGG + Intronic
1196876500 X:120159553-120159575 GGTGCCAGGGGTCTGCGGGGAGG - Intronic
1199894565 X:152117924-152117946 TGGGCCCGGGCTCTGTGAGGAGG - Intergenic
1200138544 X:153886279-153886301 GGGGCTAGGGTGCGGCGGGGCGG - Intronic
1200647560 Y:5805103-5805125 GAGCCTAGGGCTGGGCGAGGTGG + Intergenic