ID: 1135118436

View in Genome Browser
Species Human (GRCh38)
Location 16:19743726-19743748
Sequence TGTGTGACTGACCATCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135118436_1135118437 -5 Left 1135118436 16:19743726-19743748 CCACTCTGATGGTCAGTCACACA No data
Right 1135118437 16:19743744-19743766 ACACAGCTTGCTGAAAGCAGAGG No data
1135118436_1135118438 18 Left 1135118436 16:19743726-19743748 CCACTCTGATGGTCAGTCACACA No data
Right 1135118438 16:19743767-19743789 TCAGATTCTGACATGAAAGATGG No data
1135118436_1135118440 24 Left 1135118436 16:19743726-19743748 CCACTCTGATGGTCAGTCACACA No data
Right 1135118440 16:19743773-19743795 TCTGACATGAAAGATGGGTCTGG No data
1135118436_1135118439 19 Left 1135118436 16:19743726-19743748 CCACTCTGATGGTCAGTCACACA No data
Right 1135118439 16:19743768-19743790 CAGATTCTGACATGAAAGATGGG No data
1135118436_1135118441 27 Left 1135118436 16:19743726-19743748 CCACTCTGATGGTCAGTCACACA No data
Right 1135118441 16:19743776-19743798 GACATGAAAGATGGGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135118436 Original CRISPR TGTGTGACTGACCATCAGAG TGG (reversed) Intronic
No off target data available for this crispr