ID: 1135129856

View in Genome Browser
Species Human (GRCh38)
Location 16:19844399-19844421
Sequence AGTTGAACCCAATTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135129853_1135129856 -1 Left 1135129853 16:19844377-19844399 CCGGCCTTGTTGAAGACTTCAGA No data
Right 1135129856 16:19844399-19844421 AGTTGAACCCAATTTCAGCTGGG No data
1135129852_1135129856 12 Left 1135129852 16:19844364-19844386 CCACTGTGTCTGGCCGGCCTTGT No data
Right 1135129856 16:19844399-19844421 AGTTGAACCCAATTTCAGCTGGG No data
1135129854_1135129856 -5 Left 1135129854 16:19844381-19844403 CCTTGTTGAAGACTTCAGAGTTG No data
Right 1135129856 16:19844399-19844421 AGTTGAACCCAATTTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135129856 Original CRISPR AGTTGAACCCAATTTCAGCT GGG Intronic
No off target data available for this crispr