ID: 1135131451

View in Genome Browser
Species Human (GRCh38)
Location 16:19857138-19857160
Sequence ATAAGTTTACCCATAAAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135131451_1135131452 -3 Left 1135131451 16:19857138-19857160 CCTGCTTTTATGGGTAAACTTAT 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1135131452 16:19857158-19857180 TATTACCTTAATATGTTCTGTGG 0: 2
1: 0
2: 1
3: 16
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135131451 Original CRISPR ATAAGTTTACCCATAAAAGC AGG (reversed) Exonic
900355351 1:2259146-2259168 AAAACTTTACCCACAAAAGGAGG - Intronic
902297228 1:15476060-15476082 ATAAGTTTGCTCATAAAACCAGG + Intronic
904983902 1:34528751-34528773 AAAACTTTATCTATAAAAGCAGG + Intergenic
905420426 1:37839300-37839322 TTAAGTTTCCCCATCCAAGCAGG - Intronic
909321526 1:74293755-74293777 ATAATTTTATCCCTAAAATCAGG - Intronic
909398894 1:75203116-75203138 GTAAACTTGCCCATAAAAGCTGG + Intronic
909983151 1:82129329-82129351 ACATGTTTCCCCATAAATGCTGG - Intergenic
911778753 1:101848059-101848081 ATAAAGTTACCCATAAACCCTGG - Intronic
918576690 1:186069159-186069181 ATAAGTTCAGCAAGAAAAGCTGG + Intronic
919161760 1:193839551-193839573 ATAAATTAACCCATGAAGGCAGG - Intergenic
921639730 1:217538488-217538510 ATTATTTTCCCCATAAAATCTGG - Intronic
1067731469 10:48814694-48814716 GTAAGTTTCCCCATACAATCAGG - Intronic
1073313944 10:102565087-102565109 ATAATTTTACTTATAAAAACAGG - Intronic
1074798213 10:116971123-116971145 ATACATTTACCCATATGAGCAGG - Intronic
1080615137 11:33939205-33939227 GTAAGTTTACACATAGAACCAGG + Intergenic
1081104761 11:39052135-39052157 ATAAAATTACTCATAAAAACAGG - Intergenic
1081632053 11:44695895-44695917 ATGTGTTTACCCAGCAAAGCGGG + Intergenic
1081738067 11:45418438-45418460 ATAAATTTCTCCATAAAATCAGG + Intergenic
1085452179 11:76641032-76641054 AAAAGTTAACCCATAACAGATGG - Intergenic
1086725188 11:90173547-90173569 AAAAGTTTACCAAAATAAGCAGG + Intronic
1087911050 11:103753814-103753836 TAAACTTTACCCATAACAGCTGG + Intergenic
1093577546 12:20751230-20751252 ATTAGTTTGGCAATAAAAGCCGG - Intronic
1094351728 12:29533573-29533595 ATAAGTTTACCCAAAGAGTCTGG + Intronic
1099288147 12:80740659-80740681 ATAAGTTTAATGATAAAAGTTGG + Intergenic
1099593142 12:84621759-84621781 ATAAGTGTCCCCATTAAAGAAGG + Intergenic
1100798872 12:98210864-98210886 AGAATTTGGCCCATAAAAGCAGG + Intergenic
1103167975 12:118786897-118786919 CTAAGGTTACTCATAACAGCAGG - Intergenic
1104720409 12:131042150-131042172 ATAACTTTACCAAAAAAATCTGG - Intronic
1105449039 13:20482451-20482473 ATAAGTTTACTCTGAAAAGCTGG - Intronic
1107965586 13:45595426-45595448 ATAAGTGTATCTTTAAAAGCAGG + Intronic
1109477942 13:62909320-62909342 ATGATTTTACCCATTAAAACTGG - Intergenic
1111865457 13:93762710-93762732 ATAGATTTATCCATAAAGGCTGG - Intronic
1116405480 14:44560589-44560611 ATATGCTTATCCATAAAATCTGG + Intergenic
1117708017 14:58493322-58493344 ATTAGTTTCCCCACAAAATCTGG - Intronic
1118099894 14:62585887-62585909 ACTACTTTACCCATAAAATCAGG - Intergenic
1118678890 14:68218689-68218711 ATAAGTTTTCTGATATAAGCAGG - Intronic
1119045816 14:71318010-71318032 ATAATTTTGCCCTTAAAAGATGG - Intergenic
1120302991 14:82732005-82732027 ATTAATTTACTCATAAAACCAGG + Intergenic
1121428597 14:93871596-93871618 ACAATTTAACCCATAAAAGAAGG + Intergenic
1121533760 14:94677076-94677098 ATGTGTTTAGCCAGAAAAGCAGG + Intergenic
1125797480 15:42413759-42413781 AAAATTTTTCCCACAAAAGCAGG + Exonic
1126503908 15:49380509-49380531 CTAAGTAAACCCATAAAAGAAGG + Intronic
1131723713 15:95200562-95200584 ATTAAATTACCCATAAAAACTGG - Intergenic
1135131451 16:19857138-19857160 ATAAGTTTACCCATAAAAGCAGG - Exonic
1136934417 16:34445647-34445669 ATAAGTTTACCTATATAACAAGG - Intergenic
1136970155 16:34966167-34966189 ATAAGTTTACCTATATAACAAGG + Intergenic
1137518575 16:49172218-49172240 ATAAGTTTTCCCAGAAAAAATGG + Intergenic
1137821533 16:51449993-51450015 ATCATTTTAGCCCTAAAAGCAGG - Intergenic
1139233652 16:65311667-65311689 ATATGTTTACCCTTAACAGGTGG + Intergenic
1140531385 16:75669693-75669715 ATAAAATTACACATGAAAGCAGG + Intronic
1148506802 17:48133773-48133795 ATCAGTTTCCTCATAAAGGCAGG + Exonic
1150157519 17:62866575-62866597 AGACATTTACCAATAAAAGCTGG + Intergenic
1155157445 18:23169464-23169486 ATATGTTTAACCATAATAGCGGG - Intronic
1155921870 18:31611513-31611535 ACAAGGTTACCCACAAGAGCTGG - Intergenic
1155946074 18:31853053-31853075 ATATGTTTTCCCATAATTGCAGG + Intronic
1158348196 18:56537202-56537224 ATAATTTTCCCCATAAAATGTGG - Intergenic
1160312492 18:77808975-77808997 AGAAGTTCACCCTGAAAAGCTGG - Intergenic
1163868969 19:19801857-19801879 AAATGTTTACTCATAAAATCTGG + Intronic
1163936923 19:20455169-20455191 AAGAGTTTACTCATAAAACCTGG - Intergenic
1163956124 19:20642678-20642700 AAATGTTTACTCATAAAATCTGG + Intronic
1164001357 19:21102775-21102797 ACATGTTTACTCATAAAATCTGG - Intronic
1164008165 19:21171330-21171352 ACATGTTTACTCATAAAATCTGG - Intronic
1164075580 19:21814876-21814898 AAATGTTTACTCATAAAATCTGG + Intronic
1164134304 19:22399142-22399164 AAATGTTTACTCATAAAATCTGG + Intronic
1164164507 19:22657627-22657649 AAATGTTTACTCATAAAATCTGG - Intronic
1164166406 19:22680045-22680067 AAATGTTTACTCATAAAATCTGG - Intergenic
927441753 2:23123621-23123643 ATAAGTTTACGAATATTAGCAGG - Intergenic
927618009 2:24620078-24620100 AGAATTTTACCCAGAAAAACTGG - Intronic
928230211 2:29492158-29492180 ATATGATTACCTATTAAAGCAGG - Intronic
928781058 2:34820941-34820963 CAAAGTTTATCTATAAAAGCTGG + Intergenic
929262837 2:39885297-39885319 ATTGGTTTACCAATAAAAGCGGG - Intergenic
929815397 2:45227228-45227250 ACAAGTATAGCCATAAAAACCGG + Intergenic
930437009 2:51357408-51357430 ATAAATTTACACATTAAAGAAGG - Intergenic
932232704 2:70095734-70095756 AGAAGTTAATCCCTAAAAGCAGG + Intergenic
933567469 2:83968783-83968805 ATAAAGTTAACCATAACAGCTGG + Intergenic
939761063 2:146180205-146180227 ATAATTTGACCAATAAAAGAAGG - Intergenic
942595769 2:177590642-177590664 ATATGTTTTCCCCTAAAAGATGG - Intergenic
943043204 2:182827373-182827395 AAAACTTTATTCATAAAAGCAGG - Intergenic
944353806 2:198761197-198761219 ATAATTTTACCCCTAAAAATGGG + Intergenic
945602467 2:211885320-211885342 AAAGCTTTACCCAGAAAAGCTGG + Intronic
945641436 2:212436041-212436063 GTAATTATAACCATAAAAGCAGG + Intronic
946962054 2:224995909-224995931 AGAAGTTTACCTAAAAAACCTGG - Intronic
948092831 2:235309187-235309209 AAAAATTTTCCCATAAAATCAGG + Intergenic
1174731920 20:52926324-52926346 ATAAGGTTACCCATAAGAACTGG + Intergenic
1175354265 20:58350589-58350611 CTAACTTTACACATAAACGCCGG + Intronic
1184079179 22:42206163-42206185 AAAAGTTTACACAAAAAAACTGG + Intronic
1184171897 22:42764930-42764952 ACAAGTTTCCCCACAAAAGCTGG + Intergenic
949194333 3:1287438-1287460 TTAAGTTCACCCATAAAAGATGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
952836913 3:37610622-37610644 ATCAGATAACCTATAAAAGCAGG + Intronic
954997963 3:54899289-54899311 ATAATTTTGCCCAGAAAAACTGG + Intronic
960241697 3:115349956-115349978 AGAAGTTTACGCATAAATGTTGG - Intergenic
962402552 3:135073208-135073230 ATAAAAGTATCCATAAAAGCAGG - Intronic
964585404 3:158293401-158293423 AAAAGGTTTCCCATAAAACCAGG - Intronic
966043505 3:175520908-175520930 CTAATTTTACCCGTAAAAGTAGG - Intronic
968059900 3:195719719-195719741 AGAAATTTAGCCATGAAAGCTGG - Intergenic
970128690 4:12842722-12842744 ATAAGTTCTCCAATAGAAGCTGG + Intergenic
971452841 4:26816174-26816196 AAAACTTTACCTATAAAAACAGG + Intergenic
972046198 4:34667363-34667385 CTAAGTCTTCCCATAAAAACTGG - Intergenic
982488172 4:155994231-155994253 AGAACTTTACCCATATAAGATGG - Intergenic
983426509 4:167590461-167590483 TTCACTTTACCCATGAAAGCGGG + Intergenic
983574483 4:169246290-169246312 ATAAGATTACCCAAAAAAGGGGG + Intronic
986470015 5:8064227-8064249 CTGACTTTACCCAAAAAAGCTGG - Intergenic
987519281 5:18958409-18958431 ATAAGTTTAAAGAAAAAAGCTGG - Intergenic
988193822 5:27974949-27974971 AGCAGTTTAACCAGAAAAGCTGG - Intergenic
991338603 5:65579345-65579367 ACAACTTTACAGATAAAAGCTGG - Intronic
991477155 5:67034757-67034779 ATATATTTAACAATAAAAGCTGG + Intronic
993798001 5:92293844-92293866 ATAAGTGTCCTTATAAAAGCCGG + Intergenic
996985860 5:129563619-129563641 AAAAGTTTACCCATTGAAGGTGG - Intronic
997152942 5:131518884-131518906 ATAAATTAACCAATAAAAGTGGG - Intronic
1000605303 5:163320991-163321013 CTAAGTTTACCTAAAAAAGACGG - Intergenic
1000923156 5:167162329-167162351 ATATGTTGAAACATAAAAGCCGG + Intergenic
1006880919 6:37339029-37339051 AAAACTTTACCTATAAAAACAGG - Intergenic
1008154323 6:47995218-47995240 AAAAGTTTACCAACAAAAGGAGG + Intronic
1009505542 6:64473059-64473081 ATAAGTTGACTAATAAATGCTGG - Intronic
1010418682 6:75645813-75645835 ATATTTTTTCCTATAAAAGCAGG - Intronic
1010597132 6:77777673-77777695 TTAAGTATACCCATATAATCAGG + Intronic
1012410674 6:98953321-98953343 ATTAGTTCACCCATTAAATCAGG - Intergenic
1013393046 6:109705951-109705973 ATGTGCTTACCCAGAAAAGCTGG + Intronic
1014919131 6:127191896-127191918 AGAATATTACCCATAGAAGCTGG - Intronic
1015336779 6:132048234-132048256 AAAACTTTCCCCATAAAATCAGG + Intergenic
1016541027 6:145164659-145164681 ATATGTTTACCAATGAAAGGAGG - Intergenic
1021749888 7:23786105-23786127 ATAAGTTCACCCAAAAAAAAAGG - Intronic
1023483868 7:40663840-40663862 ATAATTTAAACCATAAAAGGTGG - Intronic
1025169784 7:56746051-56746073 ATAGATTTACCAATAAAAGTGGG - Intergenic
1025702107 7:63829660-63829682 ATAGATTTACCAATAAAAGTGGG + Intergenic
1025804634 7:64818945-64818967 ACATGTTTACTCATAAAATCTGG - Intronic
1025867003 7:65391942-65391964 AAATGTTTACTCATAAAACCTGG - Intronic
1026071230 7:67122040-67122062 AAAAGTTTACTGCTAAAAGCTGG - Intronic
1026705660 7:72690246-72690268 AAAAGTTTACTGCTAAAAGCTGG + Intronic
1028646366 7:93101413-93101435 CTAAGTTGACCTAAAAAAGCGGG + Exonic
1031069484 7:117145743-117145765 ATAATTTAACCCACAATAGCAGG + Intronic
1031567513 7:123319288-123319310 ATATGTCTTCCCATATAAGCAGG - Intergenic
1034102732 7:148464853-148464875 ATAAATTTATTCATAAAACCAGG + Intergenic
1034479386 7:151307983-151308005 ACAACTTAACCCATAAGAGCCGG - Intergenic
1037301459 8:17455952-17455974 ATATGGTGACCTATAAAAGCTGG + Intergenic
1038358299 8:26850972-26850994 AGAACTTTACTCACAAAAGCAGG + Intronic
1038880566 8:31606266-31606288 ATAAGTATACCCAAAAATGTGGG - Intergenic
1039654648 8:39389516-39389538 AAACATTTATCCATAAAAGCAGG - Intergenic
1044466924 8:92517928-92517950 ATAATATTGCCCATAAAAGCAGG + Intergenic
1047642056 8:126831541-126831563 ATAAGCTAACACAGAAAAGCAGG - Intergenic
1048038407 8:130700292-130700314 ATTTGTTTAAGCATAAAAGCAGG + Intergenic
1057104752 9:92402568-92402590 ATTAGTTTGCCCATAAAGGTGGG + Intronic
1058356466 9:104089488-104089510 ATAATTATCCCCATAAAAGAAGG + Intergenic
1061335669 9:129933326-129933348 AATATTTTACCCATGAAAGCTGG + Intronic
1186708671 X:12169909-12169931 AAAAGTTTACTTATAAAAACAGG + Intronic
1187322899 X:18257008-18257030 ATGAGTTTCCCCATCAAAGGAGG + Exonic
1191041186 X:56081555-56081577 AAAAGTTTCCCAATAAAATCAGG - Intergenic
1194019814 X:88673871-88673893 TGAAGTTTACCCATAACAACTGG + Intergenic