ID: 1135134014

View in Genome Browser
Species Human (GRCh38)
Location 16:19874480-19874502
Sequence CTCCATTGCAAGACGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135134007_1135134014 -6 Left 1135134007 16:19874463-19874485 CCTCCCATCCTCACTTCCTCCAT No data
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134009_1135134014 -10 Left 1135134009 16:19874467-19874489 CCATCCTCACTTCCTCCATTGCA No data
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134008_1135134014 -9 Left 1135134008 16:19874466-19874488 CCCATCCTCACTTCCTCCATTGC No data
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134002_1135134014 11 Left 1135134002 16:19874446-19874468 CCTTCCCTTCCTCCTGTCCTCCC No data
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134003_1135134014 7 Left 1135134003 16:19874450-19874472 CCCTTCCTCCTGTCCTCCCATCC 0: 1
1: 1
2: 56
3: 640
4: 4059
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134005_1135134014 2 Left 1135134005 16:19874455-19874477 CCTCCTGTCCTCCCATCCTCACT No data
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134006_1135134014 -1 Left 1135134006 16:19874458-19874480 CCTGTCCTCCCATCCTCACTTCC No data
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data
1135134004_1135134014 6 Left 1135134004 16:19874451-19874473 CCTTCCTCCTGTCCTCCCATCCT 0: 1
1: 2
2: 74
3: 887
4: 7983
Right 1135134014 16:19874480-19874502 CTCCATTGCAAGACGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135134014 Original CRISPR CTCCATTGCAAGACGTGGCA GGG Intronic
No off target data available for this crispr