ID: 1135135303

View in Genome Browser
Species Human (GRCh38)
Location 16:19882809-19882831
Sequence CTGTAGGCAGATTTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135135303_1135135309 -8 Left 1135135303 16:19882809-19882831 CCCACCCCCAAATCTGCCTACAG No data
Right 1135135309 16:19882824-19882846 GCCTACAGCTCCAGCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135135303 Original CRISPR CTGTAGGCAGATTTGGGGGT GGG (reversed) Intronic
No off target data available for this crispr