ID: 1135136200

View in Genome Browser
Species Human (GRCh38)
Location 16:19886410-19886432
Sequence CTGCGCAATTGGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135136193_1135136200 -1 Left 1135136193 16:19886388-19886410 CCCAAAGTGTGTTCCCGCCAGAC No data
Right 1135136200 16:19886410-19886432 CTGCGCAATTGGAAAGTGGATGG No data
1135136194_1135136200 -2 Left 1135136194 16:19886389-19886411 CCAAAGTGTGTTCCCGCCAGACT No data
Right 1135136200 16:19886410-19886432 CTGCGCAATTGGAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135136200 Original CRISPR CTGCGCAATTGGAAAGTGGA TGG Intergenic
No off target data available for this crispr