ID: 1135143167

View in Genome Browser
Species Human (GRCh38)
Location 16:19938955-19938977
Sequence GCCAAGTGATGCCGCTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135143167_1135143169 30 Left 1135143167 16:19938955-19938977 CCTGGTCAGCGGCATCACTTGGC No data
Right 1135143169 16:19939008-19939030 TCTCTGAATTAATAAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135143167 Original CRISPR GCCAAGTGATGCCGCTGACC AGG (reversed) Intergenic
No off target data available for this crispr