ID: 1135143169

View in Genome Browser
Species Human (GRCh38)
Location 16:19939008-19939030
Sequence TCTCTGAATTAATAAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135143168_1135143169 0 Left 1135143168 16:19938985-19939007 CCAAATGCAATTTCTCAGCTTCA No data
Right 1135143169 16:19939008-19939030 TCTCTGAATTAATAAAACTGAGG No data
1135143167_1135143169 30 Left 1135143167 16:19938955-19938977 CCTGGTCAGCGGCATCACTTGGC No data
Right 1135143169 16:19939008-19939030 TCTCTGAATTAATAAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135143169 Original CRISPR TCTCTGAATTAATAAAACTG AGG Intergenic
No off target data available for this crispr