ID: 1135146064

View in Genome Browser
Species Human (GRCh38)
Location 16:19963737-19963759
Sequence CTTCCTTGCACCTGGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135146058_1135146064 -8 Left 1135146058 16:19963722-19963744 CCATCCCTATAAGTGCTTCCTTG No data
Right 1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG No data
1135146056_1135146064 4 Left 1135146056 16:19963710-19963732 CCCTGTAAACGGCCATCCCTATA No data
Right 1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG No data
1135146057_1135146064 3 Left 1135146057 16:19963711-19963733 CCTGTAAACGGCCATCCCTATAA No data
Right 1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG No data
1135146054_1135146064 16 Left 1135146054 16:19963698-19963720 CCTTGTACTCTTCCCTGTAAACG No data
Right 1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135146064 Original CRISPR CTTCCTTGCACCTGGGCGGC TGG Intergenic
No off target data available for this crispr