ID: 1135153124

View in Genome Browser
Species Human (GRCh38)
Location 16:20027478-20027500
Sequence CTACATACCTTGAAGACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135153123_1135153124 -6 Left 1135153123 16:20027461-20027483 CCTGACTATAAGAGTTTCTACAT No data
Right 1135153124 16:20027478-20027500 CTACATACCTTGAAGACAACTGG No data
1135153119_1135153124 24 Left 1135153119 16:20027431-20027453 CCTGTAATAACTGACTCCAAATC No data
Right 1135153124 16:20027478-20027500 CTACATACCTTGAAGACAACTGG No data
1135153122_1135153124 8 Left 1135153122 16:20027447-20027469 CCAAATCTTGGGTTCCTGACTAT No data
Right 1135153124 16:20027478-20027500 CTACATACCTTGAAGACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135153124 Original CRISPR CTACATACCTTGAAGACAAC TGG Intergenic
No off target data available for this crispr