ID: 1135157951

View in Genome Browser
Species Human (GRCh38)
Location 16:20070513-20070535
Sequence CAGTCTAATTTTTAACTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135157951_1135157960 23 Left 1135157951 16:20070513-20070535 CCAACCAGTTAAAAATTAGACTG No data
Right 1135157960 16:20070559-20070581 CCTCCCAACCTAGAGACCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135157951 Original CRISPR CAGTCTAATTTTTAACTGGT TGG (reversed) Intronic
No off target data available for this crispr