ID: 1135158174

View in Genome Browser
Species Human (GRCh38)
Location 16:20072131-20072153
Sequence TCTGACTTGCCCTGCCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135158174_1135158180 -2 Left 1135158174 16:20072131-20072153 CCACCCCGGCAGGGCAAGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158174_1135158183 19 Left 1135158174 16:20072131-20072153 CCACCCCGGCAGGGCAAGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1135158183 16:20072173-20072195 GGCAGCCGTGGCGATTAGTTAGG No data
1135158174_1135158179 -3 Left 1135158174 16:20072131-20072153 CCACCCCGGCAGGGCAAGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158174_1135158181 7 Left 1135158174 16:20072131-20072153 CCACCCCGGCAGGGCAAGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135158174 Original CRISPR TCTGACTTGCCCTGCCGGGG TGG (reversed) Intronic
901773169 1:11541357-11541379 ACTGACTTGCTCTGCCCTGGAGG + Intergenic
902223752 1:14983250-14983272 GCTGAGTATCCCTGCCGGGGTGG - Intronic
903368599 1:22819864-22819886 TCTAACTGGCCCTGAGGGGGTGG - Intronic
909873489 1:80775275-80775297 GCTGGCTTGCACTGCCTGGGAGG + Intergenic
915554605 1:156654439-156654461 TCTCACTTACCCTCCCGGTGGGG - Intronic
922447619 1:225711007-225711029 CCTGACTTGCCTTGCCAAGGTGG - Intergenic
923093004 1:230753763-230753785 TCTGGCTCACCCTGCAGGGGTGG - Intronic
1064254085 10:13729342-13729364 TCTGACTTGACCGGCCTAGGTGG - Intronic
1067080477 10:43209683-43209705 TCTGCCTAGCCCTGGTGGGGGGG - Intronic
1068545122 10:58335646-58335668 CCTTCCTTGCCCTCCCGGGGAGG - Intronic
1069687128 10:70325415-70325437 TCTGACCCTCCCTGCCGAGGTGG - Intronic
1070305055 10:75234849-75234871 TGTGACTGGGCCTGCCGGGCAGG - Intronic
1073452872 10:103619896-103619918 CCTGCCTAGCCCTGCCAGGGAGG - Intronic
1075234956 10:120719386-120719408 TCTCACTTGTCCTGCCTGTGTGG - Intergenic
1077244283 11:1528608-1528630 TGTGCCTTGTCCTGCGGGGGTGG - Intergenic
1083083355 11:60116128-60116150 TCTGATGTGGCCTGCCTGGGAGG + Intergenic
1083265698 11:61545970-61545992 TCAGGCCTGCCCTGCCAGGGTGG - Intronic
1083571074 11:63762732-63762754 TCTCACTGAGCCTGCCGGGGAGG + Exonic
1085173091 11:74465336-74465358 TCTGTTTTGCCCTGCCCTGGAGG - Intronic
1087378803 11:97378478-97378500 TCTGTCTGGTCCTGCCTGGGTGG - Intergenic
1090047510 11:123349125-123349147 TCTCACTTGCCCTTTCAGGGAGG + Intergenic
1096413338 12:51392242-51392264 TCTGACTGGCGCTGCTGGTGGGG - Intronic
1096475425 12:51906671-51906693 CCTGACTGTCCCTGGCGGGGCGG + Intergenic
1102044863 12:109823310-109823332 CCAGACCTGCCCTGCCTGGGTGG - Intronic
1103024761 12:117564347-117564369 GCTGTCTTGCCCTGCCAGGAAGG - Intronic
1103607546 12:122098352-122098374 TCTGAGTTGCTCAGCGGGGGTGG - Intronic
1106467178 13:30023623-30023645 GCTGACTTGACCTGCTGGTGGGG + Intergenic
1106518704 13:30477580-30477602 ACTGCCTTGCTCTGCCAGGGAGG + Intronic
1116582871 14:46663923-46663945 CCTGACTTGCCCCACCTGGGTGG - Intergenic
1118494366 14:66293667-66293689 TCTGCCTTACCCTGCAGGGAAGG - Intergenic
1122621134 14:103058028-103058050 TCGGACCTGCCCGGCCGAGGTGG + Intergenic
1122891258 14:104733269-104733291 TCTGCCTGGCCCTGCCTGGCTGG - Intronic
1122971390 14:105153668-105153690 TCTTGCTGGCCCTGTCGGGGAGG - Intronic
1124998482 15:34747103-34747125 TCTGACTCGCCGTGCCTGGTGGG + Intergenic
1129446493 15:75622585-75622607 TCTGACTTGCACTGCTGGGCTGG + Intronic
1130255762 15:82325459-82325481 TCTGACTGCCCCTGGAGGGGTGG - Intergenic
1130599201 15:85264527-85264549 TCTGACTGCCCCTGGAGGGGTGG + Intergenic
1132511270 16:342803-342825 TCTGACTTTGCCTGCCTGGTGGG - Intronic
1135158174 16:20072131-20072153 TCTGACTTGCCCTGCCGGGGTGG - Intronic
1135249163 16:20885919-20885941 TCTGACTTGTTCTGTTGGGGTGG - Intronic
1137825519 16:51491186-51491208 TCTGCCTGGCCCTGCCAGAGAGG + Intergenic
1203148328 16_KI270728v1_random:1817219-1817241 TCCGACGGGCCCGGCCGGGGTGG - Intergenic
1144567761 17:16374083-16374105 TCTGACTTGCCCAGGCTGGAGGG - Intergenic
1145155806 17:20544791-20544813 TTTGACTTGCTCTGCGGGAGCGG + Intergenic
1147429372 17:40362125-40362147 TCTGATATGCACTGCGGGGGTGG - Intronic
1150225931 17:63524415-63524437 TCTGTCTTGTCCAGCCAGGGTGG + Intronic
1151408420 17:73904241-73904263 TCAGACTTGCCCTGCCTTGGCGG + Intergenic
1153224330 18:2886893-2886915 TCTCACTTGCCCTACCTGGACGG + Intronic
1159864472 18:73687971-73687993 GCTGACTTGCCCACACGGGGAGG + Intergenic
1160803140 19:979734-979756 TCTGAGTTCCCCAGCCTGGGAGG + Intergenic
1161584612 19:5098490-5098512 CCTGACTTGCCCAGCCTGTGGGG + Intronic
1162810615 19:13162725-13162747 TCTGCCCTGCCCTGCCGTGCAGG + Intergenic
1166094904 19:40532320-40532342 GCTGACTGGCCCTGCCTTGGGGG + Intronic
927151620 2:20199547-20199569 TCCCACTTGCCCTGCCTGGGAGG - Intergenic
928169094 2:28991939-28991961 TCTGAATTGCTCTGCCTGGCTGG - Intronic
928319282 2:30270258-30270280 GCTGGCTTGCCCTGGCTGGGAGG + Intronic
933951979 2:87338805-87338827 TCTGACTGGCCCTGCAGGAGAGG - Intergenic
934134084 2:88978674-88978696 TCTGACTGGCCCTGCAGGAGAGG + Intergenic
934139022 2:89027374-89027396 TCTGACTGGCCCTGCAGGAGAGG + Intergenic
934145093 2:89085380-89085402 TCTGACTGGCCCTGCAGGAGAGG + Intergenic
934150387 2:89142780-89142802 TCTGACTGGCCCTGCAGGAGAGG + Intergenic
934216907 2:90039251-90039273 TCTGACTGGCCCCGCAGGAGAGG - Intergenic
934224162 2:90115175-90115197 TCTGACTGGCCCTGCAGGAGAGG - Intergenic
934230223 2:90173187-90173209 TCTGACTGGCCCTGCAGGAGAGG - Intergenic
934236221 2:90235140-90235162 TCTGACTGGCCCTGCAGGAGAGG - Intergenic
935145474 2:100392362-100392384 TCTGACTTGCCTTACCTGGGTGG - Exonic
937575316 2:123413613-123413635 TCTGACTTGCTTTGCGGGAGAGG + Intergenic
946702631 2:222428026-222428048 TCTGACTTCCCCTGACTGTGTGG - Intronic
947217644 2:227763753-227763775 TCTGCCATGCTCTGACGGGGAGG + Intergenic
947394458 2:229673411-229673433 TTGGACTTGCCCTCCTGGGGAGG + Intronic
947394703 2:229675189-229675211 TTGGACTTGCCCTCCTGGGGAGG - Intronic
948609660 2:239158757-239158779 TGTGACCTGCCCTGACGGTGAGG - Intronic
949081074 2:242100223-242100245 TTTTTCTTTCCCTGCCGGGGAGG - Intergenic
1174271508 20:49372965-49372987 TCTGAACTGCCCTGCCTTGGAGG - Exonic
1176044497 20:63085346-63085368 TCTGAGATGCCCTGCAGGCGAGG - Intergenic
1176151403 20:63592964-63592986 TCTCACAAGCCCTGGCGGGGTGG - Intronic
1177174417 21:17689110-17689132 TTTGTCTTGCACTACCGGGGTGG + Intergenic
1178365515 21:31986240-31986262 TCTTCCTTGCACTGCTGGGGAGG - Intronic
1180708865 22:17826253-17826275 TCTGAGCTGCCCTGAAGGGGGGG + Intronic
1180854257 22:19036431-19036453 TCTGACCTGCCATGCGGAGGTGG - Exonic
1180914415 22:19475314-19475336 CCTGACTTGCTCTGTTGGGGTGG - Intronic
1181236561 22:21450771-21450793 TCTGACATTCCACGCCGGGGTGG + Exonic
1183377949 22:37475931-37475953 CCTGCCTTGCCCTGGCTGGGAGG - Intronic
1185409937 22:50676565-50676587 ACTCACTTGCTCAGCCGGGGTGG + Intergenic
949470400 3:4390113-4390135 TCTCTCTTCCCCTGCCAGGGTGG - Intronic
949862852 3:8522250-8522272 TCTGCCTTCCCCTCCAGGGGAGG - Intronic
950556532 3:13699321-13699343 ACTGACCTGCCCAGCAGGGGAGG + Intergenic
951436428 3:22670439-22670461 TCTGCGCTGCCCTGCCGTGGTGG - Intergenic
952843712 3:37669260-37669282 TCACCCTTGCCCTGCCTGGGAGG + Intronic
953768772 3:45763308-45763330 ACTGAGCTGCCCTGCAGGGGTGG + Intronic
959667946 3:108942574-108942596 TCTTACCTGCCCTGCTGGGATGG + Intronic
960816681 3:121680200-121680222 TCTTCCTTCCCCTGCCGGTGTGG + Intronic
961094197 3:124140779-124140801 GCAGCCTTGCCCTCCCGGGGGGG + Intronic
963034517 3:141013787-141013809 TCTGGCTGGCCCTGCCGGAAAGG - Intergenic
965811440 3:172594817-172594839 TCTGCATTGCCTTGGCGGGGAGG - Intergenic
968598156 4:1495928-1495950 GCTGCCCTGCCCTGCCAGGGAGG + Intergenic
969108496 4:4826548-4826570 TCTGTCTTGCCCAGGCGTGGTGG - Intergenic
969691015 4:8704224-8704246 TCAGACTTTCCCTGCCCTGGTGG + Intergenic
996128181 5:119750782-119750804 ACTGACTTGTCCTGCCAGGTTGG - Intergenic
999175546 5:149629194-149629216 TCTCACTTGCCCTGCTGATGAGG - Intronic
1001462231 5:171926315-171926337 TCTCACTTACTCTGCCAGGGAGG - Intronic
1001897096 5:175391809-175391831 TCTGACTCGGCCGGCCGCGGTGG - Intergenic
1003965867 6:11251580-11251602 TCTGACCTGCCCTGCCGCCTTGG - Intronic
1015904979 6:138107533-138107555 CCCGACCTGCCCTGCCGGGCCGG + Intergenic
1019024462 6:168947232-168947254 ACTGACTTTCCATGCCGTGGTGG - Intergenic
1019442512 7:1054609-1054631 TCTGACTTGGCCTCACGGCGGGG + Intronic
1019680838 7:2348276-2348298 TCTGCCTTGTCCTTCCTGGGTGG - Intronic
1022104527 7:27188661-27188683 TCGGACTTGGCCTTCCGGGGCGG - Intergenic
1023027629 7:36065153-36065175 TATGACTGGCCCTGATGGGGGGG + Intergenic
1029935990 7:104424702-104424724 TCTGACTTGGCCGGGCGCGGTGG + Intronic
1033137763 7:138798789-138798811 CCTGCCTTGCCCTGCCAGGCCGG + Intronic
1046516417 8:115267743-115267765 GCTGACTTGCCGTGGCTGGGAGG - Intergenic
1048553699 8:135456468-135456490 TGTGACTTGCTTTGCCAGGGAGG + Intergenic
1049394862 8:142395299-142395321 TCTACCTTGCCCTCCCCGGGAGG + Intronic
1049395325 8:142397561-142397583 TCTGATTTGCCCTGTGGGGAGGG - Intronic
1050024219 9:1317107-1317129 TCTGACTTGCCCTACCCAGTAGG + Intergenic
1052883821 9:33624087-33624109 TCTGCCTCGGCCTGCCTGGGTGG - Intergenic
1057421374 9:94915720-94915742 GTTGACTTGCCCTGCTGGGCTGG - Intronic
1059407219 9:114108662-114108684 TCTGACCTGTCCTGGCGGGTAGG - Intergenic
1059929654 9:119248441-119248463 ACTGACTGGCCCTGATGGGGAGG + Intronic
1195965029 X:110422237-110422259 TCTGACTTGCCAGTCAGGGGAGG - Intronic
1201498647 Y:14617781-14617803 TCAGAGTTGCCCTGCCAGTGAGG + Intronic