ID: 1135158176

View in Genome Browser
Species Human (GRCh38)
Location 16:20072134-20072156
Sequence GCCTCTGACTTGCCCTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135158176_1135158183 16 Left 1135158176 16:20072134-20072156 CCCCGGCAGGGCAAGTCAGAGGC No data
Right 1135158183 16:20072173-20072195 GGCAGCCGTGGCGATTAGTTAGG No data
1135158176_1135158179 -6 Left 1135158176 16:20072134-20072156 CCCCGGCAGGGCAAGTCAGAGGC No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158176_1135158180 -5 Left 1135158176 16:20072134-20072156 CCCCGGCAGGGCAAGTCAGAGGC No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158176_1135158181 4 Left 1135158176 16:20072134-20072156 CCCCGGCAGGGCAAGTCAGAGGC No data
Right 1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135158176 Original CRISPR GCCTCTGACTTGCCCTGCCG GGG (reversed) Intronic
No off target data available for this crispr