ID: 1135158178

View in Genome Browser
Species Human (GRCh38)
Location 16:20072136-20072158
Sequence CAGCCTCTGACTTGCCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135158178_1135158180 -7 Left 1135158178 16:20072136-20072158 CCGGCAGGGCAAGTCAGAGGCTG No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158178_1135158181 2 Left 1135158178 16:20072136-20072158 CCGGCAGGGCAAGTCAGAGGCTG No data
Right 1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG No data
1135158178_1135158183 14 Left 1135158178 16:20072136-20072158 CCGGCAGGGCAAGTCAGAGGCTG No data
Right 1135158183 16:20072173-20072195 GGCAGCCGTGGCGATTAGTTAGG No data
1135158178_1135158179 -8 Left 1135158178 16:20072136-20072158 CCGGCAGGGCAAGTCAGAGGCTG No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135158178 Original CRISPR CAGCCTCTGACTTGCCCTGC CGG (reversed) Intronic
No off target data available for this crispr