ID: 1135158179

View in Genome Browser
Species Human (GRCh38)
Location 16:20072151-20072173
Sequence AGAGGCTGAGCTGCTCTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135158174_1135158179 -3 Left 1135158174 16:20072131-20072153 CCACCCCGGCAGGGCAAGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158176_1135158179 -6 Left 1135158176 16:20072134-20072156 CCCCGGCAGGGCAAGTCAGAGGC No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158178_1135158179 -8 Left 1135158178 16:20072136-20072158 CCGGCAGGGCAAGTCAGAGGCTG No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158170_1135158179 28 Left 1135158170 16:20072100-20072122 CCAGCTCAAGGTAATTACAGGAC No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158169_1135158179 29 Left 1135158169 16:20072099-20072121 CCCAGCTCAAGGTAATTACAGGA No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data
1135158177_1135158179 -7 Left 1135158177 16:20072135-20072157 CCCGGCAGGGCAAGTCAGAGGCT No data
Right 1135158179 16:20072151-20072173 AGAGGCTGAGCTGCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135158179 Original CRISPR AGAGGCTGAGCTGCTCTCCT AGG Intronic
No off target data available for this crispr