ID: 1135158180

View in Genome Browser
Species Human (GRCh38)
Location 16:20072152-20072174
Sequence GAGGCTGAGCTGCTCTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135158170_1135158180 29 Left 1135158170 16:20072100-20072122 CCAGCTCAAGGTAATTACAGGAC No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158169_1135158180 30 Left 1135158169 16:20072099-20072121 CCCAGCTCAAGGTAATTACAGGA No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158174_1135158180 -2 Left 1135158174 16:20072131-20072153 CCACCCCGGCAGGGCAAGTCAGA 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158178_1135158180 -7 Left 1135158178 16:20072136-20072158 CCGGCAGGGCAAGTCAGAGGCTG No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158176_1135158180 -5 Left 1135158176 16:20072134-20072156 CCCCGGCAGGGCAAGTCAGAGGC No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data
1135158177_1135158180 -6 Left 1135158177 16:20072135-20072157 CCCGGCAGGGCAAGTCAGAGGCT No data
Right 1135158180 16:20072152-20072174 GAGGCTGAGCTGCTCTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135158180 Original CRISPR GAGGCTGAGCTGCTCTCCTA GGG Intronic
No off target data available for this crispr