ID: 1135161667

View in Genome Browser
Species Human (GRCh38)
Location 16:20102029-20102051
Sequence CTGCTTGTGTTTGAAAGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135161667_1135161673 13 Left 1135161667 16:20102029-20102051 CCTAACCTTTCAAACACAAGCAG No data
Right 1135161673 16:20102065-20102087 GTGCAGAGGCACTTAGGTTATGG No data
1135161667_1135161672 7 Left 1135161667 16:20102029-20102051 CCTAACCTTTCAAACACAAGCAG No data
Right 1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG No data
1135161667_1135161674 18 Left 1135161667 16:20102029-20102051 CCTAACCTTTCAAACACAAGCAG No data
Right 1135161674 16:20102070-20102092 GAGGCACTTAGGTTATGGAGAGG No data
1135161667_1135161675 21 Left 1135161667 16:20102029-20102051 CCTAACCTTTCAAACACAAGCAG No data
Right 1135161675 16:20102073-20102095 GCACTTAGGTTATGGAGAGGAGG No data
1135161667_1135161671 -1 Left 1135161667 16:20102029-20102051 CCTAACCTTTCAAACACAAGCAG No data
Right 1135161671 16:20102051-20102073 GTGTCTGTCTGGGTGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135161667 Original CRISPR CTGCTTGTGTTTGAAAGGTT AGG (reversed) Intergenic
No off target data available for this crispr