ID: 1135161668

View in Genome Browser
Species Human (GRCh38)
Location 16:20102034-20102056
Sequence AGACACTGCTTGTGTTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135161668_1135161675 16 Left 1135161668 16:20102034-20102056 CCTTTCAAACACAAGCAGTGTCT No data
Right 1135161675 16:20102073-20102095 GCACTTAGGTTATGGAGAGGAGG No data
1135161668_1135161671 -6 Left 1135161668 16:20102034-20102056 CCTTTCAAACACAAGCAGTGTCT No data
Right 1135161671 16:20102051-20102073 GTGTCTGTCTGGGTGTGCAGAGG No data
1135161668_1135161672 2 Left 1135161668 16:20102034-20102056 CCTTTCAAACACAAGCAGTGTCT No data
Right 1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG No data
1135161668_1135161673 8 Left 1135161668 16:20102034-20102056 CCTTTCAAACACAAGCAGTGTCT No data
Right 1135161673 16:20102065-20102087 GTGCAGAGGCACTTAGGTTATGG No data
1135161668_1135161674 13 Left 1135161668 16:20102034-20102056 CCTTTCAAACACAAGCAGTGTCT No data
Right 1135161674 16:20102070-20102092 GAGGCACTTAGGTTATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135161668 Original CRISPR AGACACTGCTTGTGTTTGAA AGG (reversed) Intergenic
No off target data available for this crispr