ID: 1135161672

View in Genome Browser
Species Human (GRCh38)
Location 16:20102059-20102081
Sequence CTGGGTGTGCAGAGGCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135161668_1135161672 2 Left 1135161668 16:20102034-20102056 CCTTTCAAACACAAGCAGTGTCT No data
Right 1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG No data
1135161667_1135161672 7 Left 1135161667 16:20102029-20102051 CCTAACCTTTCAAACACAAGCAG No data
Right 1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135161672 Original CRISPR CTGGGTGTGCAGAGGCACTT AGG Intergenic
No off target data available for this crispr