ID: 1135165188

View in Genome Browser
Species Human (GRCh38)
Location 16:20132944-20132966
Sequence GGAGAGGTTAAGCACATCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135165182_1135165188 30 Left 1135165182 16:20132891-20132913 CCTTAGGGTTAGGAATGACTATC No data
Right 1135165188 16:20132944-20132966 GGAGAGGTTAAGCACATCACGGG No data
1135165184_1135165188 6 Left 1135165184 16:20132915-20132937 CCATTTTATAGACGAGGAAAAAG No data
Right 1135165188 16:20132944-20132966 GGAGAGGTTAAGCACATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135165188 Original CRISPR GGAGAGGTTAAGCACATCAC GGG Intergenic
No off target data available for this crispr