ID: 1135166297

View in Genome Browser
Species Human (GRCh38)
Location 16:20141969-20141991
Sequence AACTGTGGTTTGCACTAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135166297_1135166299 -5 Left 1135166297 16:20141969-20141991 CCGGTCTAGTGCAAACCACAGTT No data
Right 1135166299 16:20141987-20142009 CAGTTACCATCTGTGTCAGTCGG No data
1135166297_1135166300 -4 Left 1135166297 16:20141969-20141991 CCGGTCTAGTGCAAACCACAGTT No data
Right 1135166300 16:20141988-20142010 AGTTACCATCTGTGTCAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135166297 Original CRISPR AACTGTGGTTTGCACTAGAC CGG (reversed) Intergenic
No off target data available for this crispr