ID: 1135167321

View in Genome Browser
Species Human (GRCh38)
Location 16:20150883-20150905
Sequence CAAGGGAAAGTCTCTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167321_1135167327 22 Left 1135167321 16:20150883-20150905 CCTGCTACAGAGACTTTCCCTTG No data
Right 1135167327 16:20150928-20150950 GAAAGAGCCTATTGATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167321 Original CRISPR CAAGGGAAAGTCTCTGTAGC AGG (reversed) Intergenic
No off target data available for this crispr