ID: 1135167710

View in Genome Browser
Species Human (GRCh38)
Location 16:20155497-20155519
Sequence TGTAACAAACAACCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3307
Summary {0: 3, 1: 19, 2: 155, 3: 785, 4: 2345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167709_1135167710 -5 Left 1135167709 16:20155479-20155501 CCTGGGAGCTGGGGCTGCTGTAA No data
Right 1135167710 16:20155497-20155519 TGTAACAAACAACCACAAACTGG 0: 3
1: 19
2: 155
3: 785
4: 2345
1135167703_1135167710 12 Left 1135167703 16:20155462-20155484 CCCAGTGGTGCTGGTGGCCTGGG No data
Right 1135167710 16:20155497-20155519 TGTAACAAACAACCACAAACTGG 0: 3
1: 19
2: 155
3: 785
4: 2345
1135167705_1135167710 11 Left 1135167705 16:20155463-20155485 CCAGTGGTGCTGGTGGCCTGGGA No data
Right 1135167710 16:20155497-20155519 TGTAACAAACAACCACAAACTGG 0: 3
1: 19
2: 155
3: 785
4: 2345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167710 Original CRISPR TGTAACAAACAACCACAAAC TGG Intergenic
Too many off-targets to display for this crispr