ID: 1135167959

View in Genome Browser
Species Human (GRCh38)
Location 16:20157098-20157120
Sequence GTGGCAAATGAGGCATTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167959 Original CRISPR GTGGCAAATGAGGCATTTGT TGG (reversed) Intergenic
900886974 1:5422069-5422091 GTGGCAAAAGAGGAAATTGCTGG - Intergenic
902173253 1:14629955-14629977 TTGGCAAATGCTGCATTTGGGGG - Intronic
904784051 1:32972537-32972559 GTGGGACTTGAGGCATCTGTCGG + Intergenic
907251768 1:53144198-53144220 TTGGAAAATGAGGCATTTGTTGG - Intergenic
907522222 1:55031530-55031552 GGGGCAGATGAGGAACTTGTTGG + Intergenic
908068694 1:60434851-60434873 GATGGAAATGAGGAATTTGTTGG - Intergenic
908679256 1:66641482-66641504 GAGGAAGATGAAGCATTTGTAGG - Intronic
913181767 1:116329399-116329421 GTGGCAACTGAGGAATTTGGAGG - Intergenic
915465591 1:156096085-156096107 GAGGGAAAGGAGGCATGTGTTGG - Intronic
918402624 1:184178629-184178651 GTGACATATGAGGCTATTGTAGG - Intergenic
918863117 1:189859457-189859479 GTTGCAAATGTAGCATATGTGGG + Intergenic
922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG + Intergenic
924294844 1:242576401-242576423 GTGGCAAATAAGGCATCTAATGG + Intergenic
1064789565 10:18940866-18940888 GTGGCTGCTGTGGCATTTGTGGG - Intergenic
1069399286 10:68025417-68025439 GTGGCAAAATAGGTATTTGGGGG + Intronic
1069930229 10:71876786-71876808 CTTGCAAATGATGCATTTGGTGG - Intergenic
1070601309 10:77868321-77868343 GTGGCGAATTAGGCAGATGTGGG - Intronic
1073178710 10:101571161-101571183 GGGACAAGTGAGGCATGTGTGGG + Intronic
1074688225 10:115979431-115979453 GTAGCAAAAGAGACATTTGAGGG - Intergenic
1074833086 10:117263565-117263587 GTGGCAGATGAGGAATTTGGGGG - Intronic
1076625731 10:131820665-131820687 GTGGAAAATGAGGCAGGTGGAGG - Intergenic
1077009063 11:372080-372102 GTGGCACATGAGGCCTGTCTCGG - Intronic
1077330503 11:1982040-1982062 GTGGCAAATGAGGTGCTTGGCGG - Intronic
1077667194 11:4122993-4123015 GGGGAAAATGAGGCAGTTTTAGG - Intronic
1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG + Exonic
1078329418 11:10407490-10407512 GGGGCATATGGGGCATTTGGGGG + Intronic
1078578986 11:12524517-12524539 GTCGCAAAGGAGGAATTTGGGGG - Intronic
1080088435 11:28315276-28315298 GTTGGAAATGAGGAACTTGTTGG + Intronic
1082947116 11:58772292-58772314 CTGGTAAATAGGGCATTTGTAGG + Intergenic
1083121954 11:60521575-60521597 ATGGAAGATGAGGAATTTGTTGG - Intronic
1083632791 11:64104382-64104404 GTGGCAAATGATGCTTATGCCGG - Intronic
1084121005 11:67068908-67068930 GAAGCAAATGGGGCCTTTGTGGG - Intronic
1084467450 11:69334288-69334310 TAGGCAAAGGGGGCATTTGTTGG + Intronic
1084634997 11:70385960-70385982 CTGGCAAAAGATGCAGTTGTGGG + Intergenic
1084843903 11:71884193-71884215 GTAGTAAATGAGGCAGTAGTTGG - Intronic
1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG + Intergenic
1086507626 11:87522478-87522500 ATGGCAGATGAGGCATTTGCTGG - Intergenic
1088715780 11:112548146-112548168 GTGGAAAATGAGGGATGAGTGGG - Intergenic
1091087617 11:132737874-132737896 GTGGAAACAGTGGCATTTGTTGG + Intronic
1091317806 11:134627167-134627189 GTGACAAATGACTCATTTCTTGG - Intergenic
1202813481 11_KI270721v1_random:37219-37241 GTGGCAAATGAGGTGCTTGGCGG - Intergenic
1097326522 12:58283541-58283563 CTGGCAAAAGAGGTAGTTGTAGG - Intergenic
1098551460 12:71766405-71766427 GTGGAAAATGAGGCATAAGGAGG - Intronic
1098569099 12:71968783-71968805 GTGGTACAGGAGGAATTTGTTGG + Intronic
1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG + Intronic
1098757047 12:74377813-74377835 GTGGCCAGTGAGGCAATTATAGG + Intergenic
1099324073 12:81189978-81190000 GAAGCAAATGAGGTATTTGTAGG - Intronic
1100120820 12:91367441-91367463 GTGGCCAATAAGGCAATTTTTGG + Intergenic
1101198652 12:102411876-102411898 GTGGTAGAAGAGGCATTTGATGG + Intronic
1102460508 12:113096981-113097003 CTGGCGAAGGAGGCATTTGCCGG - Exonic
1104479625 12:129096280-129096302 GTGGCATGTGAGGCATATGACGG - Intronic
1107135646 13:36941052-36941074 TTGGCAAGAGAGGCATTTATTGG + Intergenic
1108814957 13:54279018-54279040 GTGGAAGATCAGGCAGTTGTAGG + Intergenic
1110988749 13:82009967-82009989 GTGCTAAATGAGGGATTTGTGGG + Intergenic
1111872908 13:93856486-93856508 TAGGCAAATGAGAAATTTGTAGG + Intronic
1112495953 13:99905006-99905028 GAGGCAAAGGAGGCAGATGTGGG - Intergenic
1112841046 13:103578207-103578229 GTGGAAAAAAAGCCATTTGTTGG - Intergenic
1113629632 13:111873469-111873491 GTGGCTGATGAGGCATTTTGGGG - Intergenic
1114061581 14:19022552-19022574 GTGGCATAGGAGACATTTGGTGG - Intergenic
1114100668 14:19377393-19377415 GTGGCATAGGAGACATTTGGTGG + Intergenic
1115011208 14:28547359-28547381 GTGGAAAATGAGTGATTTTTAGG - Intergenic
1117566265 14:56996661-56996683 GGGCCAAAGGAGGCATTTGTGGG - Intergenic
1117660774 14:58002080-58002102 GTAGTAAATCAGGCACTTGTAGG - Exonic
1117896725 14:60495204-60495226 GTGGCAAATGCGACATTCATTGG + Intronic
1118040627 14:61912382-61912404 ATGACCAATGAGTCATTTGTTGG + Intergenic
1119512566 14:75222883-75222905 GTGGAAAATAAGGCATGTGGTGG - Intergenic
1119991623 14:79204348-79204370 TTACCATATGAGGCATTTGTTGG - Intronic
1120275315 14:82366211-82366233 GTGGCAGATGATGCAGTTTTTGG - Intergenic
1121407981 14:93730538-93730560 GTGGGAACTGAGGCCTTGGTGGG - Intronic
1123219540 14:106843190-106843212 GTGGTAAATATGTCATTTGTAGG - Intergenic
1123495640 15:20822419-20822441 GTGGCATAGGAGACATTTGGTGG + Intergenic
1123552127 15:21391511-21391533 GTGGCATAGGAGACATTTGGTGG + Intergenic
1123588371 15:21828908-21828930 GTGGCATAGGAGACATTTGGTGG + Intergenic
1125600630 15:40913736-40913758 GGGGCCAGTGAGGCATTTGTTGG - Intergenic
1125618541 15:41037977-41037999 GGGGCAAGAGAGGCATTTGGTGG - Intronic
1126740562 15:51772603-51772625 GTGGCAGAGGATGCATCTGTGGG + Intronic
1129869460 15:78931406-78931428 GTGGGAAATGAGGAAGTTTTGGG + Intronic
1130349078 15:83074677-83074699 GTTGGAAATGAGGCACTTATTGG - Intergenic
1130515311 15:84621781-84621803 GCCGCACATGAGGCATTTGTAGG - Exonic
1131469959 15:92688241-92688263 GAGGGAAATGAGGAATTTATTGG + Intronic
1132415101 15:101613897-101613919 GTGGGAAGCAAGGCATTTGTGGG - Intergenic
1202960475 15_KI270727v1_random:118742-118764 GTGGCATAGGAGACATTTGGTGG + Intergenic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1135714617 16:24751796-24751818 ATGGCAGGTGAGGCATTTATGGG + Intronic
1135868092 16:26123381-26123403 CTTCCAAAAGAGGCATTTGTGGG + Intronic
1137683943 16:50373045-50373067 GTGCCAAATGAGGCACTAGCTGG - Intergenic
1138849316 16:60607220-60607242 GTGGCAGATGTGACATTTATGGG - Intergenic
1138849985 16:60616249-60616271 GGGGTAAATGAGGCTTTTGGTGG + Intergenic
1140035860 16:71370812-71370834 ATGGGGAAGGAGGCATTTGTGGG - Intronic
1140260097 16:73370801-73370823 GTGGCCAGTGAGGCATATATTGG - Intergenic
1141285187 16:82665161-82665183 GTGGCAAATGTGGCATTAAATGG - Intronic
1141884847 16:86884457-86884479 TTGCCAAATGAGGCATTACTGGG + Intergenic
1142976648 17:3648579-3648601 ATGACAAATGAGGCATCTGGAGG - Intronic
1144234138 17:13240579-13240601 GAGGGAAATGAGGAATTTGTTGG - Intergenic
1146262432 17:31430802-31430824 GTGGGAAATGAGGGAGCTGTGGG + Intronic
1147051119 17:37795871-37795893 TTGTCAAATGAGGCATTTCCAGG - Intergenic
1150180384 17:63113039-63113061 GTGGCAAATGTGGAATTTAAGGG + Intronic
1154453045 18:14494846-14494868 GTGGCATAGGAGACATTTGGTGG + Intergenic
1159150931 18:64522887-64522909 GTGGGAAATGGGGCAGTAGTTGG + Intergenic
1159295981 18:66489304-66489326 GTGGTAAATAAGGCATATGTAGG - Intergenic
1159868646 18:73735599-73735621 GTGGCAAAAGAGGCAGTCATGGG + Intergenic
926381639 2:12296373-12296395 GGGACAAATGAGGCAGGTGTAGG + Intergenic
927289013 2:21386525-21386547 GTGCCAGATCAGGCTTTTGTTGG - Intergenic
927469459 2:23361955-23361977 GAGGAAACTGAGGCATGTGTAGG + Intergenic
928867181 2:35930874-35930896 GTGGCAAATGATGTTTTGGTGGG - Intergenic
931495379 2:62800654-62800676 GTGGTCAATGAAGCATTTGAAGG + Intronic
934788625 2:97036511-97036533 GAAGCAAATGAGACGTTTGTGGG - Intergenic
935039722 2:99414720-99414742 GTGGGAAGTGAGGCAATAGTGGG - Intronic
935419834 2:102855342-102855364 GATGGAAATGAGGAATTTGTTGG - Intergenic
935666186 2:105515135-105515157 GTGGCAGAAGGTGCATTTGTCGG + Intergenic
938478937 2:131642858-131642880 GTGGCATAGGAGACATTTGGTGG - Intergenic
939249121 2:139663223-139663245 GATGCAAATGAGGAATTTATTGG - Intergenic
940501875 2:154503871-154503893 GATGGAAATGAGGAATTTGTTGG + Intergenic
940616623 2:156056705-156056727 GTGGTAAATAATGCATTTCTAGG + Intergenic
941063393 2:160873414-160873436 GTGACATTTGAGGAATTTGTCGG - Intergenic
941636287 2:167938693-167938715 GTAGCAAAAGAGGCATATGGAGG + Intergenic
942649252 2:178149588-178149610 TTGGCCAATGGGGCATTAGTAGG - Intergenic
943832212 2:192477619-192477641 GACGAAAATGAGGAATTTGTTGG + Intergenic
1169858088 20:10124856-10124878 GATGGAAATGAGGAATTTGTTGG - Intergenic
1169938450 20:10911025-10911047 GTGCGAAATGCTGCATTTGTTGG - Intergenic
1171187394 20:23132677-23132699 GAGTCAAATGAGGTAATTGTAGG + Intergenic
1173937115 20:46876469-46876491 GTGGCAAATCATCTATTTGTTGG + Intergenic
1174214986 20:48909578-48909600 GTGGAAAATGAGGGATGTGAAGG - Intergenic
1174255044 20:49248326-49248348 GTGGCAGATCCGGCATTTCTTGG + Exonic
1174409667 20:50326585-50326607 CTGGCAAATGTGAAATTTGTAGG + Intergenic
1174578174 20:51552372-51552394 GAAGCCAATGAGGCATTTGGGGG - Intronic
1174609943 20:51790767-51790789 GTGGCAAATGAGACATTCGTTGG + Exonic
1175013736 20:55765956-55765978 GTGTCAAAGGAGGGATTTGGTGG - Intergenic
1176728873 21:10469484-10469506 GTTGCAAATGATGCATTTCCAGG + Intergenic
1178796976 21:35753881-35753903 GTTGCAAATGCAGCATTTATAGG - Intronic
1178854262 21:36237697-36237719 TTGGCAAAATAGGCAGTTGTAGG + Intronic
1180480069 22:15745151-15745173 GTGGCATAGGAGACATTTGGTGG - Intergenic
1180716517 22:17876279-17876301 GTGGGAAATGAAGCAGTTATTGG - Intronic
1183411204 22:37655791-37655813 GTGGGCACTGAGGCACTTGTGGG - Exonic
1184781443 22:46651675-46651697 GTGGCAGGTCATGCATTTGTGGG + Intronic
950161377 3:10763681-10763703 GCTGAAAATGAGGCAGTTGTGGG - Intergenic
952568023 3:34681517-34681539 ATGGTTAATGTGGCATTTGTGGG + Intergenic
952831496 3:37568740-37568762 GAGGGAGATGAGGAATTTGTTGG - Intronic
952969577 3:38642267-38642289 ATGGCAACTGAGGCATTTATGGG + Intronic
957232436 3:77537788-77537810 GTGGCAAGAGAGCCCTTTGTGGG + Intronic
958647333 3:96889094-96889116 GATGCAAATGAGGAACTTGTTGG - Intronic
958821896 3:98984586-98984608 GGGGCAAATGAAGCTTTTGCAGG - Intergenic
959817022 3:110685748-110685770 ATGGAAATTGAGCCATTTGTAGG + Intergenic
959837643 3:110939240-110939262 AAGGAAAATGAGCCATTTGTGGG - Intergenic
960094072 3:113671236-113671258 TGGGCAAATGAGGCCTTTCTAGG + Intronic
961089029 3:124093819-124093841 GTGGCATTTGAGTTATTTGTTGG + Intronic
961666582 3:128496741-128496763 GTGGTAAATGATGCATTCGATGG - Intergenic
962160405 3:132993276-132993298 TTGGCAAATGAAGCATAGGTGGG - Intergenic
962325279 3:134427347-134427369 GTGACAAATGAAGCATTCTTGGG + Intergenic
965962458 3:174444351-174444373 GTGGTACATGAGAAATTTGTAGG + Intronic
966032910 3:175372632-175372654 AAGGCCAATGAGGCATATGTTGG - Intronic
966202024 3:177367493-177367515 GTGGCCAAGGAGGCAGTTATTGG + Intergenic
966866981 3:184263550-184263572 GTGGCAAAGGTGGCAGTTGGCGG + Intronic
967102158 3:186224432-186224454 GTGGCAAATGACACATTTGGAGG - Intronic
969606280 4:8203854-8203876 GAGGCAAATCAGGCAGCTGTTGG - Intronic
969993142 4:11284573-11284595 GAGGGAAATGAGGAACTTGTTGG - Intergenic
971451198 4:26803667-26803689 GTGGCAAACGGTGCATTTGGAGG + Intergenic
972909136 4:43792224-43792246 GTGGTAAATGACCCATATGTTGG - Intergenic
973255774 4:48111561-48111583 GTGGAAAAAGAGGCATTAGTAGG - Intronic
973547226 4:51994228-51994250 GATGCAAATGAGGGTTTTGTGGG - Exonic
973552428 4:52049035-52049057 GATGGAAATGAGGAATTTGTTGG - Intergenic
973723347 4:53747774-53747796 GTGGCAAACTAGACATTTCTAGG - Intronic
974651032 4:64754585-64754607 GATGGAAATGAGGCATTTATTGG + Intergenic
977895215 4:102357058-102357080 ATGGAAAAAGAGGCATTTTTTGG + Intronic
980192075 4:129537878-129537900 GTGAGAAATGAGGCACTAGTTGG + Intergenic
981110258 4:140926715-140926737 GTGGCAGAAGGGGCATTTGGTGG + Intronic
982373397 4:154658971-154658993 GTGGCCAATGGGAAATTTGTAGG + Intronic
984921103 4:184765221-184765243 GTGGCAGACGGGGCATGTGTGGG - Intronic
987438837 5:17931502-17931524 GTGGGAAATGAAGCATATGTAGG + Intergenic
987709114 5:21486620-21486642 GAGGGAGATGAGGAATTTGTTGG - Intergenic
988585691 5:32505640-32505662 GTGGCAGATGGGGCATCTGTGGG + Intergenic
988750498 5:34187533-34187555 GAGGGAGATGAGGAATTTGTTGG + Intergenic
989296703 5:39836101-39836123 GAGCCAAATGGAGCATTTGTTGG - Intergenic
990329515 5:54712268-54712290 GATGGAAATGAGGCACTTGTTGG + Intergenic
990363336 5:55043749-55043771 GGGGCTATTGAGGCATGTGTTGG - Intergenic
990607400 5:57424021-57424043 GTCGCAAATGAGACATTCGTTGG - Intergenic
990642775 5:57806493-57806515 GTGGCAACTGATACATTTGTAGG + Intergenic
991268709 5:64753223-64753245 GAAGTAAATGAAGCATTTGTAGG + Intronic
991272708 5:64803884-64803906 GTGGGAAATGTGGCTTTTGAAGG - Intronic
991738758 5:69650731-69650753 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991759439 5:69905696-69905718 GAGGCAGATGAGGAATTTGTTGG - Intergenic
991787896 5:70212422-70212444 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991790333 5:70230472-70230494 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991815082 5:70505563-70505585 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991818217 5:70526848-70526870 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991838667 5:70780762-70780784 GAGGGAGATGAGGAATTTGTTGG - Intergenic
991880342 5:71212786-71212808 GAGGCAGATGAGGAATTTGTTGG + Intergenic
991882783 5:71230812-71230834 GAGGGAGATGAGGAATTTGTTGG + Intergenic
993379951 5:87195538-87195560 GTAGTAAATCAGGCATTTGAAGG - Intergenic
993929855 5:93924553-93924575 TTGGCAAATGAGACAATTATTGG - Intronic
994513505 5:100739803-100739825 GTGGTACATGAGGGATTTGGGGG - Intergenic
994849562 5:105036620-105036642 GATGGAAATGAGGAATTTGTTGG - Intergenic
996442180 5:123504058-123504080 GAGCCAGATGTGGCATTTGTAGG + Intergenic
997666237 5:135631581-135631603 CTGGAAAATTAGCCATTTGTTGG - Intergenic
998133604 5:139663315-139663337 GTGGCAAATGGAGCCTTTGCAGG + Intronic
999624197 5:153502713-153502735 GGGGCAAATGAGGCAGTTGGAGG + Intronic
1000588907 5:163134413-163134435 TTGTTAAATGAGGAATTTGTAGG - Intergenic
1000802173 5:165741214-165741236 GTGTGAAATAAAGCATTTGTAGG + Intergenic
1001015853 5:168140393-168140415 GTGGCAGGGGAGGCATTAGTGGG - Intronic
1004833379 6:19501978-19502000 GTGAAAAATGAGGAATTTGATGG - Intergenic
1005118061 6:22360150-22360172 GTGGGAAATCAGGAATGTGTAGG + Intergenic
1005548568 6:26893838-26893860 GAGGGAGATGAGGAATTTGTGGG + Intergenic
1005925939 6:30445664-30445686 GGGGCAAGCAAGGCATTTGTGGG + Intergenic
1006495305 6:34418771-34418793 GTGGTAATTAAGGCTTTTGTGGG - Intronic
1007040042 6:38713579-38713601 TTTTCAAAAGAGGCATTTGTAGG + Intergenic
1008681541 6:53877700-53877722 GTGGGAGATGAGGAACTTGTTGG - Intronic
1008718460 6:54318725-54318747 GTGGGAAATGAGGGATCCGTTGG + Intronic
1008902492 6:56637346-56637368 GTGGCAAAGGAGTCAAGTGTTGG - Intronic
1009019324 6:57934945-57934967 GAGGGAGATGAGGAATTTGTTGG + Intergenic
1010472649 6:76247727-76247749 GTGGAGAATGAGACATTTCTGGG + Intergenic
1013865505 6:114691397-114691419 GATGGAAATGAGGAATTTGTTGG - Intergenic
1015297633 6:131616176-131616198 GTGTCAAATGAGGCAAATGAGGG - Intronic
1016324245 6:142881264-142881286 ATGGAAAATTAGGCACTTGTGGG + Intronic
1019150503 6:170002408-170002430 GAGGGAAATGAGGAACTTGTTGG - Intergenic
1028766502 7:94565563-94565585 GTGATAATTGAGGCATTTGAAGG - Intergenic
1029534967 7:101151998-101152020 GTAGCACATGATGCAATTGTTGG - Intergenic
1029873921 7:103727458-103727480 GTGGCTAATGAGCCTTTTTTTGG - Intronic
1029936699 7:104432532-104432554 GTGGCAATTGAGGCCTTTGAAGG - Intronic
1032072739 7:128818927-128818949 GTGGCAACTGGAGGATTTGTTGG + Intronic
1032492360 7:132333217-132333239 GTGGCTAGTGGGGAATTTGTGGG + Intronic
1035130547 7:156649168-156649190 GTAGAAAATGAGGCAGTTTTAGG - Intronic
1035452203 7:158984619-158984641 GACGGAAATGAGGAATTTGTTGG - Intergenic
1038737252 8:30182101-30182123 GTGGGAAATGAAGCTTGTGTTGG + Intronic
1039518257 8:38150825-38150847 CTGGCAAATGTGGCAGTGGTGGG + Exonic
1041273303 8:56131134-56131156 GTGGCAAATGAGAGAGATGTAGG + Intergenic
1042261052 8:66859519-66859541 GAGGCAGATGATGCATTCGTTGG + Exonic
1042602441 8:70511992-70512014 GAGGGAAATGAGGAACTTGTTGG + Intergenic
1044253176 8:90028190-90028212 GCGGCACAAGAGGCTTTTGTTGG - Intronic
1045362714 8:101448081-101448103 GTGGCAAATGTTGCATTCTTTGG + Intergenic
1046682522 8:117186063-117186085 GTGCCAAATGAGGAAGTTGAAGG - Intergenic
1046802711 8:118446998-118447020 GCTACAAATGAGGCATTTTTAGG - Intronic
1048480900 8:134791822-134791844 GTGGCAAATGAGACATAAGCTGG + Intergenic
1049044741 8:140140616-140140638 GTGGGACATGAGGGATTTATGGG - Intronic
1052597562 9:30579609-30579631 GTGGCATAGAAGGCATTTGTTGG + Intergenic
1052793796 9:32903346-32903368 GTGGCAAATGTTGCATTTAAAGG - Intergenic
1052862739 9:33447011-33447033 GAGGCAAATGAGCCATTATTAGG - Intronic
1054782694 9:69180139-69180161 GTGACAAGTCAGGCATTTGGAGG + Intronic
1056481177 9:87007907-87007929 TTGGCTGATAAGGCATTTGTAGG + Intergenic
1056814845 9:89793606-89793628 GTGACAGATGAGTCATATGTAGG + Intergenic
1057723811 9:97554385-97554407 GTGGCACTTGAGGCACCTGTGGG + Intronic
1059530186 9:115028365-115028387 GTGGCAATTGAGTACTTTGTAGG + Intronic
1059630154 9:116113165-116113187 GAGGAAAAAGAGGCATCTGTAGG + Intergenic
1062059024 9:134484725-134484747 GTGGCACAGGAGGCTTTTATGGG - Intergenic
1186768382 X:12793331-12793353 GTGGCACATGTGGTATTTTTAGG - Intronic
1186843180 X:13505569-13505591 ATGGCACAGGAGCCATTTGTAGG + Intergenic
1189052799 X:37664119-37664141 CTGGGAAATGAGGCACTTGCTGG + Intronic
1190625749 X:52336928-52336950 ATGGGAAATGAGGCCTGTGTTGG + Intergenic
1194799046 X:98248690-98248712 GTGGCAATTGAGACATTCATGGG - Intergenic
1195640715 X:107171747-107171769 GTGGCAAAAGTAGTATTTGTAGG + Intronic
1195918559 X:109959586-109959608 GTGGCAACTGAAGCATAAGTAGG - Intergenic
1197738743 X:129872807-129872829 GTGGCAAATGAGACATTCACTGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1199269088 X:145862201-145862223 TTGGCCAAGAAGGCATTTGTGGG - Intergenic