ID: 1135167963

View in Genome Browser
Species Human (GRCh38)
Location 16:20157143-20157165
Sequence GATGCAGCAATGCATTTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167963_1135167968 15 Left 1135167963 16:20157143-20157165 CCCTTTAAATGCATTGCTGCATC 0: 1
1: 0
2: 3
3: 31
4: 423
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167963 Original CRISPR GATGCAGCAATGCATTTAAA GGG (reversed) Intergenic