ID: 1135167964

View in Genome Browser
Species Human (GRCh38)
Location 16:20157144-20157166
Sequence GGATGCAGCAATGCATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167964_1135167968 14 Left 1135167964 16:20157144-20157166 CCTTTAAATGCATTGCTGCATCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167964 Original CRISPR GGATGCAGCAATGCATTTAA AGG (reversed) Intergenic