ID: 1135167965

View in Genome Browser
Species Human (GRCh38)
Location 16:20157165-20157187
Sequence GGAATGGTGTCTCTGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167965_1135167968 -7 Left 1135167965 16:20157165-20157187 CCATACTCCAGAGACACCATTCC 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136
1135167965_1135167970 14 Left 1135167965 16:20157165-20157187 CCATACTCCAGAGACACCATTCC 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1135167970 16:20157202-20157224 GGCTGAGCTTTTTCTACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167965 Original CRISPR GGAATGGTGTCTCTGGAGTA TGG (reversed) Intergenic