ID: 1135167968

View in Genome Browser
Species Human (GRCh38)
Location 16:20157181-20157203
Sequence CCATTCCAATGTAAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167964_1135167968 14 Left 1135167964 16:20157144-20157166 CCTTTAAATGCATTGCTGCATCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136
1135167965_1135167968 -7 Left 1135167965 16:20157165-20157187 CCATACTCCAGAGACACCATTCC 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136
1135167963_1135167968 15 Left 1135167963 16:20157143-20157165 CCCTTTAAATGCATTGCTGCATC 0: 1
1: 0
2: 3
3: 31
4: 423
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167968 Original CRISPR CCATTCCAATGTAAGATCTG TGG Intergenic