ID: 1135167968

View in Genome Browser
Species Human (GRCh38)
Location 16:20157181-20157203
Sequence CCATTCCAATGTAAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135167963_1135167968 15 Left 1135167963 16:20157143-20157165 CCCTTTAAATGCATTGCTGCATC 0: 1
1: 0
2: 3
3: 31
4: 423
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136
1135167965_1135167968 -7 Left 1135167965 16:20157165-20157187 CCATACTCCAGAGACACCATTCC 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136
1135167964_1135167968 14 Left 1135167964 16:20157144-20157166 CCTTTAAATGCATTGCTGCATCC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135167968 Original CRISPR CCATTCCAATGTAAGATCTG TGG Intergenic
900707186 1:4088230-4088252 CCATGCCAATGGCAAATCTGTGG - Intergenic
908085723 1:60631695-60631717 CCAGTCCAGTGTGAGATCTTGGG + Intergenic
910441036 1:87252292-87252314 CAATTCCAATATAAGATGTAAGG - Intergenic
910479336 1:87641301-87641323 CCATTGCTAGCTAAGATCTGAGG + Intergenic
911054946 1:93701369-93701391 CCATTCCAATGGAAGACACGTGG - Intronic
911365443 1:96932213-96932235 ACATTCCAATCTTAGCTCTGGGG + Intergenic
913002484 1:114595114-114595136 CCATTAGACTGTAAGACCTGAGG + Intronic
913045882 1:115073195-115073217 CCAGTCCAATGTCACATCAGGGG - Intronic
917680616 1:177362741-177362763 GCATTCCTATGTAAGATGTTGGG - Intergenic
917742943 1:177979082-177979104 GCATTCCAATAGAAGACCTGTGG - Intronic
921578403 1:216865280-216865302 CCCTTCCAAAGGAAGTTCTGAGG - Intronic
921769217 1:219015519-219015541 GCATTTCCATGTAAGTTCTGTGG - Intergenic
923464865 1:234239362-234239384 CTATCCCAATGTAAGAAATGTGG + Intronic
1063852378 10:10207616-10207638 CCAGCCAAATATAAGATCTGGGG - Intergenic
1065459278 10:25939421-25939443 CCTTTCTAATGTAAAATTTGAGG + Intronic
1073255789 10:102150235-102150257 GCATTCCTATGTAAGATAGGAGG + Exonic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1074780835 10:116800782-116800804 CCATTCAAATGCAAACTCTGAGG + Intergenic
1075467263 10:122661097-122661119 CCATGTCACTGTAAGACCTGAGG - Intergenic
1075995491 10:126873357-126873379 CAATTCCGATGGAGGATCTGAGG + Intergenic
1079086019 11:17445520-17445542 CCATTCCCGTGTAAGCCCTGAGG - Intronic
1079834577 11:25317333-25317355 ACATTCCTATGGAAGACCTGGGG + Intergenic
1080713423 11:34772514-34772536 CCATTCCAAGGTAAAAGATGAGG + Intergenic
1085426781 11:76411782-76411804 CTATTCCAATGTTACAGCTGAGG - Intronic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1090633228 11:128669094-128669116 CCATTACAAGGTAGTATCTGTGG - Intergenic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1117491973 14:56257265-56257287 ACATTACACTGTAAGCTCTGAGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1120316085 14:82895171-82895193 TCTTTCTAATGTAAGCTCTGTGG - Intergenic
1121405043 14:93714623-93714645 CCATTTCAATGTAAGATGGCGGG - Intergenic
1127570226 15:60234536-60234558 CCATTCCAAAGGAAGAGGTGTGG + Intergenic
1128688487 15:69705362-69705384 CCATTCCCCTGTAAGACCTTAGG - Intergenic
1129153162 15:73701999-73702021 CCATTAAAATGTAAGTTCTGTGG + Intronic
1133483168 16:6191788-6191810 GCATTCCAAGGAAAGCTCTGTGG - Intronic
1133553242 16:6879774-6879796 CCATTCCAATGTCAAATCAGAGG - Intronic
1133720318 16:8488694-8488716 CTATTCCCTTGTAAGACCTGTGG - Intergenic
1134354430 16:13467764-13467786 CCACTCCCATGTAGGATCTTGGG + Intergenic
1134676892 16:16097075-16097097 CCTTTGGAATTTAAGATCTGAGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1135244024 16:20838831-20838853 CCATCCCAAGAGAAGATCTGTGG + Intronic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1141359692 16:83384129-83384151 CAATTCCAATCTAATATCTAAGG + Intronic
1144088977 17:11836259-11836281 ACATTCCAATGTGAGGTATGAGG - Intronic
1144839764 17:18178707-18178729 CCACCCCAAGGTAAGAGCTGGGG + Intronic
1148082747 17:44976559-44976581 CCACTCCAAGGTAAGATGCGGGG + Intergenic
1158123548 18:54077396-54077418 CAATTCCAATGCAACATCAGAGG - Intergenic
1159982839 18:74806973-74806995 CCATAACAATGTAAGCTCTATGG - Intronic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1162247456 19:9413936-9413958 CCCTTTGAATGTAAGATATGTGG - Exonic
1164931746 19:32181149-32181171 CCATTACAATATAATATCAGAGG - Intergenic
1165583592 19:36892306-36892328 CCATGGGAATGTAAGATATGTGG - Exonic
1166587787 19:43966427-43966449 CCATTCAAATGTGATATATGTGG + Exonic
1166587895 19:43967432-43967454 CCATTCAAATATGAGAACTGTGG + Exonic
1166590794 19:43996716-43996738 CCATTCAAATGTGATATATGTGG + Exonic
1166590857 19:43997304-43997326 CCATTCAAATGTGAGGACTGTGG + Exonic
1166594371 19:44032440-44032462 CCATTCAAATGTGAAATATGTGG + Exonic
1166600127 19:44086334-44086356 CCATTCAAATGTTATATATGTGG + Exonic
1166602238 19:44107019-44107041 CCATTCAAATGTGATATATGTGG + Exonic
1166628874 19:44387532-44387554 CCTTTCCCATGTAATAACTGTGG - Exonic
1167977151 19:53237753-53237775 CCATATCAATGTAATATATGTGG - Exonic
1168442696 19:56384215-56384237 CCCTACCAATGTAAGGTATGTGG - Exonic
925242020 2:2339689-2339711 CCATTCCTTTCTAAGAACTGGGG + Intergenic
929401022 2:41581856-41581878 CCTTTCCAAAGTCAGATATGAGG + Intergenic
929979808 2:46667603-46667625 CCATTCCAATTTCAATTCTGTGG + Intergenic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
932198177 2:69802292-69802314 CCATTCCAATTCAAGATTTCAGG - Intronic
933998793 2:87689196-87689218 CCATTTCAATATGAGATTTGGGG + Intergenic
936106354 2:109627938-109627960 ACATTCCAATGAAAGATTTGTGG + Intergenic
936295056 2:111261682-111261704 CCATTTCAATATGAGATTTGGGG - Intergenic
937161656 2:119768537-119768559 CAATTCCAATCTAACATCTCAGG + Intronic
937553044 2:123118630-123118652 CCATTCCTATGGAAACTCTGAGG - Intergenic
943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG + Exonic
944568613 2:201018966-201018988 CCATTCTAATATAAGAAGTGCGG - Intronic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
948595539 2:239077067-239077089 GCATTCCAGGGTAGGATCTGGGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174935560 20:54864394-54864416 CAATTGCAATGTAACAACTGAGG - Intergenic
1176989720 21:15480835-15480857 CCATTAGATTGTAAGGTCTGGGG - Intergenic
1179132651 21:38652321-38652343 CCATTCCATAGGAAGATCAGAGG - Intronic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
958627835 3:96648703-96648725 CCATTGGAAAGTAACATCTGAGG + Intergenic
958764757 3:98353564-98353586 CTATGCCGATGTAAAATCTGTGG - Intergenic
959308672 3:104701757-104701779 ACATTCCATTGTAAGGTATGTGG + Intergenic
959472194 3:106765670-106765692 CCAGTCCAAGCTAAGGTCTGAGG - Intergenic
962169547 3:133086696-133086718 TCATTCCTATGTATGATCTCTGG - Intronic
963046901 3:141109366-141109388 CCTTTCCACTGTAAGATGAGGGG - Intronic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
963460544 3:145608493-145608515 CCATCCCCAAGTAGGATCTGGGG - Intergenic
963624694 3:147656417-147656439 CCATTCTAATGGAAAAGCTGTGG - Intergenic
968820246 4:2844239-2844261 CTATCCCGATGAAAGATCTGCGG - Intronic
970988715 4:22188634-22188656 ACATTAGAATGTAAGGTCTGTGG + Intergenic
972844067 4:42966296-42966318 CCATTCCAATGTGGGTTTTGTGG - Intronic
978778107 4:112522520-112522542 CCTTTTGAATGTAAGCTCTGTGG - Intergenic
983064890 4:163197066-163197088 CAATTCCAAAGTAACTTCTGAGG - Intergenic
983373142 4:166890029-166890051 TTATTCCAATGTAAGACCTATGG - Intronic
983548990 4:168995173-168995195 ACCTACCAATGTAAGAACTGAGG - Intronic
983655368 4:170078072-170078094 CCATTCCAAGGTTAGATCCGTGG - Intronic
985030700 4:185786538-185786560 ACATTCCAAGGAAAGAACTGAGG + Intronic
987039505 5:14048494-14048516 CCATTCCACAGATAGATCTGAGG + Intergenic
990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG + Intergenic
992678413 5:79128758-79128780 CCATTGGAATGTAAACTCTGAGG - Intronic
993154300 5:84202867-84202889 CCATTCCACTGGAAGAAATGAGG + Intronic
993470217 5:88298574-88298596 CCATTTCAATGTGATATCTCAGG - Intergenic
994296556 5:98096352-98096374 ACATTCCAATGAAACCTCTGTGG + Intergenic
996763859 5:127015615-127015637 CCCTTCCAAACTAAAATCTGAGG + Intronic
996999146 5:129738543-129738565 ACAATCCAATGTATGTTCTGAGG + Exonic
1000973754 5:167742304-167742326 CCATTCAAATTTAAATTCTGGGG - Intronic
1004557264 6:16711246-16711268 CCATTTCAAATTAAGATATGAGG - Intronic
1004954176 6:20709032-20709054 CCATTGCAATGTAAGCTCCAAGG + Intronic
1006272706 6:32976455-32976477 CCTTGCCAAGGTATGATCTGTGG + Exonic
1014399944 6:120975893-120975915 CCCTTCCAAGGTAAGATGGGAGG + Intergenic
1014573116 6:123036066-123036088 CAATTCCATTGTAAAATTTGAGG + Intronic
1014771579 6:125463737-125463759 CCATTCCAATGGAGGAGATGGGG - Intergenic
1018461787 6:164005545-164005567 ACATTCCAATCCAAGAGCTGTGG - Intergenic
1018769785 6:166960275-166960297 CCATTCCAATGGCAGAGCAGTGG + Intergenic
1020146044 7:5643917-5643939 CCATTCCTATGAAATATCAGAGG - Intronic
1022856115 7:34316158-34316180 CTATTCCAAAGTAAGCCCTGGGG - Intergenic
1024126335 7:46300585-46300607 CTAATCCATTGTAAGATATGTGG - Intergenic
1024404199 7:48959386-48959408 TCATTCAAATGTAAGATCAATGG - Intergenic
1026823763 7:73568225-73568247 CCATCCCACTGTCAGCTCTGTGG - Intergenic
1027703391 7:81497568-81497590 CCATTCTAGTGGAATATCTGGGG + Intergenic
1028680960 7:93531070-93531092 ACATTCCATTGTAATCTCTGTGG - Intronic
1037914232 8:22762733-22762755 CCACTCCAATCAAAGAACTGTGG + Intronic
1038387894 8:27166753-27166775 CCATTCCACTGTCAGATCATGGG + Intergenic
1038692379 8:29774854-29774876 CCATTCCTAAGTCAGATCAGAGG + Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1049338212 8:142097762-142097784 CCATTCCCATGCAAGATTTCAGG - Intergenic
1050765036 9:9122157-9122179 TCATTTCACTGTAAGATCTCAGG - Intronic
1050985835 9:12080812-12080834 CAATTAGAAAGTAAGATCTGGGG - Intergenic
1052226832 9:26099767-26099789 ACATTGAAATGTAAGAGCTGAGG + Intergenic
1055069571 9:72152192-72152214 CCATTGCAAGTTTAGATCTGGGG + Intronic
1059564904 9:115374279-115374301 TCATTCCAATGAATGATGTGTGG - Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG + Exonic
1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG + Intronic
1187625192 X:21104094-21104116 CCATTCCAATTAAAGTTGTGTGG + Intergenic
1187885561 X:23885765-23885787 CCATTCCACAGCAAGAACTGTGG + Intronic
1188251896 X:27906569-27906591 CCTTTCCAATGAAAGACATGTGG + Intergenic
1190336118 X:49263088-49263110 CCATTCCAAATAAAGAGCTGTGG + Intronic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1194926141 X:99826599-99826621 CAGTTCCAATGGAAGAACTGTGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1198955817 X:142129142-142129164 CCATTCCCTTATTAGATCTGTGG + Intergenic
1198993347 X:142543000-142543022 ACATTACAAGGTATGATCTGTGG + Intergenic
1201596602 Y:15677244-15677266 TCATTACAATTTAAGTTCTGGGG - Intergenic