ID: 1135171332

View in Genome Browser
Species Human (GRCh38)
Location 16:20186653-20186675
Sequence TCAGAAATTCCAGGAGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171332_1135171336 15 Left 1135171332 16:20186653-20186675 CCTCTAGCTCCTGGAATTTCTGA No data
Right 1135171336 16:20186691-20186713 GATGTATCTACCTGGAAAGCAGG No data
1135171332_1135171337 16 Left 1135171332 16:20186653-20186675 CCTCTAGCTCCTGGAATTTCTGA No data
Right 1135171337 16:20186692-20186714 ATGTATCTACCTGGAAAGCAGGG No data
1135171332_1135171338 17 Left 1135171332 16:20186653-20186675 CCTCTAGCTCCTGGAATTTCTGA No data
Right 1135171338 16:20186693-20186715 TGTATCTACCTGGAAAGCAGGGG No data
1135171332_1135171335 7 Left 1135171332 16:20186653-20186675 CCTCTAGCTCCTGGAATTTCTGA No data
Right 1135171335 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171332 Original CRISPR TCAGAAATTCCAGGAGCTAG AGG (reversed) Intergenic