ID: 1135171333

View in Genome Browser
Species Human (GRCh38)
Location 16:20186662-20186684
Sequence GGAATATGCTCAGAAATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171333_1135171337 7 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171337 16:20186692-20186714 ATGTATCTACCTGGAAAGCAGGG No data
1135171333_1135171342 30 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171342 16:20186715-20186737 GTCCTAATGCTTCAGGTTGGAGG No data
1135171333_1135171336 6 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171336 16:20186691-20186713 GATGTATCTACCTGGAAAGCAGG No data
1135171333_1135171341 27 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171341 16:20186712-20186734 GGGGTCCTAATGCTTCAGGTTGG No data
1135171333_1135171340 23 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171340 16:20186708-20186730 AGCAGGGGTCCTAATGCTTCAGG No data
1135171333_1135171338 8 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171338 16:20186693-20186715 TGTATCTACCTGGAAAGCAGGGG No data
1135171333_1135171335 -2 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171335 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171333 Original CRISPR GGAATATGCTCAGAAATTCC AGG (reversed) Intergenic
No off target data available for this crispr