ID: 1135171334

View in Genome Browser
Species Human (GRCh38)
Location 16:20186683-20186705
Sequence CCAGGTAGATACATCTTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171334_1135171345 16 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171345 16:20186722-20186744 TGCTTCAGGTTGGAGGCTATGGG No data
1135171334_1135171342 9 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171342 16:20186715-20186737 GTCCTAATGCTTCAGGTTGGAGG No data
1135171334_1135171340 2 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171340 16:20186708-20186730 AGCAGGGGTCCTAATGCTTCAGG No data
1135171334_1135171344 15 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171344 16:20186721-20186743 ATGCTTCAGGTTGGAGGCTATGG No data
1135171334_1135171341 6 Left 1135171334 16:20186683-20186705 CCTAAGAAGATGTATCTACCTGG No data
Right 1135171341 16:20186712-20186734 GGGGTCCTAATGCTTCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171334 Original CRISPR CCAGGTAGATACATCTTCTT AGG (reversed) Intergenic