ID: 1135171338

View in Genome Browser
Species Human (GRCh38)
Location 16:20186693-20186715
Sequence TGTATCTACCTGGAAAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171333_1135171338 8 Left 1135171333 16:20186662-20186684 CCTGGAATTTCTGAGCATATTCC No data
Right 1135171338 16:20186693-20186715 TGTATCTACCTGGAAAGCAGGGG No data
1135171332_1135171338 17 Left 1135171332 16:20186653-20186675 CCTCTAGCTCCTGGAATTTCTGA No data
Right 1135171338 16:20186693-20186715 TGTATCTACCTGGAAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171338 Original CRISPR TGTATCTACCTGGAAAGCAG GGG Intergenic