ID: 1135171339

View in Genome Browser
Species Human (GRCh38)
Location 16:20186701-20186723
Sequence CATTAGGACCCCTGCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135171339_1135171342 -9 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171342 16:20186715-20186737 GTCCTAATGCTTCAGGTTGGAGG No data
1135171339_1135171345 -2 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171345 16:20186722-20186744 TGCTTCAGGTTGGAGGCTATGGG No data
1135171339_1135171344 -3 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171344 16:20186721-20186743 ATGCTTCAGGTTGGAGGCTATGG No data
1135171339_1135171346 21 Left 1135171339 16:20186701-20186723 CCTGGAAAGCAGGGGTCCTAATG No data
Right 1135171346 16:20186745-20186767 AAAGAAGTCCTGCAGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135171339 Original CRISPR CATTAGGACCCCTGCTTTCC AGG (reversed) Intergenic